Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-let-7e-5p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
XLOC_007993
hsa-let-7e-5p
0.985

Gene Details
Chromosome: chrX
Transcript: TCONS_00017181
Biotype: transcript isomorph
Gene id: XLOC_007993
Gene Name: XLOC_007993
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
186-209
0.073
5
6mer
76-101
0.005
3
XLOC_001668
hsa-let-7e-5p
0.984

Gene Details
Chromosome: chr2
Transcript: TCONS_00003870
Biotype: transcript isomorph
Gene id: XLOC_001668
Gene Name: XLOC_001668
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
100-120
0.038
2
7mer
2144-2165
0.019
2
6mer
469-483
0.012
2
6mer
2702-2728
0.005
2
6mer
2403-2424
0.005
2
XLOC_012784
hsa-let-7e-5p
0.983

Gene Details
Chromosome: chr18
Transcript: TCONS_00026436
Biotype: transcript isomorph
Gene id: XLOC_012784
Gene Name: XLOC_012784
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HREpiC Kidney Normal/Primary
- Lymph Node Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2291-2312
0.064
1
6mer
66-93
0.013
1
TSIX
hsa-let-7e-5p
0.982

Gene Details
Chromosome: X
Transcript: ENST00000604411
Biotype: lincRNA
Gene id: ENSG00000270641
Gene Name: TSIX
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
396-411
0.058
2
7mer
26176-26196
0.003
2
7mer
11206-11226
0.003
Not Conserved
6mer
26905-26926
0.002
2
6mer
4100-4119
0.002
2
6mer
18737-18761
0.002
2
6mer
23486-23510
0.002
2
6mer
726-740
0.001
1
6mer
7550-7575
0.001
1
6mer
16014-16034
0.001
Not Conserved
6mer
25100-25118
0.001
1
6mer
4120-4137
0.001
1
XIST
hsa-let-7e-5p
0.982

Gene Details
Chromosome: X
Transcript: ENST00000421322
Biotype: lincRNA
Gene id: ENSG00000229807
Gene Name: XIST
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
- Lymph Node Normal/Primary
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
227-251
0.076
2
LOC100506639
hsa-let-7e-5p
0.982

Gene Details
Chromosome: 5
Transcript: NR_102752.1
Biotype: sense
Gene id: NR_102752.1 (gene)
Gene Name: LOC100506639
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1067-1093
0.059
2
6mer
487-514
0.009
2
6mer
597-618
0.008
2
RP11-552D8.1
hsa-let-7e-5p
0.981

Gene Details
Chromosome: 1
Transcript: ENST00000446560
Biotype: antisense
Gene id: ENSG00000229258
Gene Name: RP11-552D8.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
227-248
0.060
1
8mer
140-166
0.013
2
6mer
186-209
0.002
Not Conserved
RP11-705C15.3
hsa-let-7e-5p
0.981

Gene Details
Chromosome: 12
Transcript: ENST00000537616
Biotype: sense_intronic
Gene id: ENSG00000257027
Gene Name: RP11-705C15.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1828-1853
0.070
2
8mer+wobble
62-79
0.005
1
CTA-384D8.35
hsa-let-7e-5p
0.980

Gene Details
Chromosome: 22
Transcript: ENST00000609178
Biotype: lincRNA
Gene id: ENSG00000272666
Gene Name: CTA-384D8.35
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
407-428
0.074
2
RP11-421M1.8
hsa-let-7e-5p
0.979

Gene Details
Chromosome: 6
Transcript: ENST00000606522
Biotype: lincRNA
Gene id: ENSG00000272097
Gene Name: RP11-421M1.8
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
669-694
0.043
3
9mer
494-518
0.030
1
BACE1-AS
hsa-let-7e-5p
0.979

Gene Details
Chromosome: 11
Transcript: NR_037803.1
Biotype: antisense
Gene id: NR_037803.1 (gene)
Gene Name: BACE1-AS
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
653-666
0.073
8
RP11-420K14.8
hsa-let-7e-5p
0.976

Gene Details
Chromosome: 19
Transcript: ENST00000593824
Biotype: lincRNA
Gene id: ENSG00000268184
Gene Name: RP11-420K14.8
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
281-306
0.072
1
RP11-347H15.4
hsa-let-7e-5p
0.976

Gene Details
Chromosome: 11
Transcript: ENST00000525654
Biotype: lincRNA
Gene id: ENSG00000254518
Gene Name: RP11-347H15.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
231-257
0.071
2
XLOC_003898
hsa-let-7e-5p
0.973

Gene Details
Chromosome: chr4
Transcript: TCONS_00008445
Biotype: transcript isomorph
Gene id: XLOC_003898
Gene Name: XLOC_003898
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
HepG2 Liver Cancer/Malignant
Fibroblasts Lung Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
415-436
0.065
2
6mer
456-479
0.004
3
AC008067.2
hsa-let-7e-5p
0.968

Gene Details
Chromosome: 2
Transcript: ENST00000596783
Biotype: antisense
Gene id: ENSG00000237031
Gene Name: AC008067.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
28-43
0.066
3
TRG-AS1
hsa-let-7e-5p
0.967

Gene Details
Chromosome: 7
Transcript: NR_040085.1
Biotype: lincRNA
Gene id: NR_040085.1 (gene)
Gene Name: TRG-AS1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
3380-3393
0.064
2
8mer+wobble
1761-1776
0.002
Not Conserved
RP11-161H23.9
hsa-let-7e-5p
0.966

Gene Details
Chromosome: 12
Transcript: ENST00000553259
Biotype: antisense
Gene id: ENSG00000258334
Gene Name: RP11-161H23.9
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
81-98
0.065
3
6mer
2654-2675
0.001
2
RP5-875H18.4
hsa-let-7e-5p
0.966

Gene Details
Chromosome: 17
Transcript: ENST00000511361
Biotype: antisense
Gene id: ENSG00000250282
Gene Name: RP5-875H18.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
12-28
0.060
2
6mer
54-68
0.005
3
RP11-357K6.2
hsa-let-7e-5p
0.965

Gene Details
Chromosome: 12
Transcript: ENST00000538783
Biotype: lincRNA
Gene id: ENSG00000255814
Gene Name: RP11-357K6.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
152-167
0.065
4
AC005162.5
hsa-let-7e-5p
0.964

Gene Details
Chromosome: 7
Transcript: ENST00000411479
Biotype: antisense
Gene id: ENSG00000233517
Gene Name: AC005162.5
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
432-456
0.065
4
Funded by: