Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-let-7e-5p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
XLOC_012598
hsa-let-7e-5p
0.964

Gene Details
Chromosome: chr18
Transcript: TCONS_00026224
Biotype: transcript isomorph
Gene id: XLOC_012598
Gene Name: XLOC_012598
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1574-1593
0.053
1
6mer
2031-2055
0.012
1
AC005789.11
hsa-let-7e-5p
0.964

Gene Details
Chromosome: 19
Transcript: ENST00000588453
Biotype: lincRNA
Gene id: ENSG00000267473
Gene Name: AC005789.11
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
904-925
0.054
8
6mer
1267-1286
0.004
4
6mer
1130-1156
0.004
5
6mer
277-291
0.002
1
RP11-53B2.2
hsa-let-7e-5p
0.964

Gene Details
Chromosome: 18
Transcript: ENST00000587344
Biotype: sense_intronic
Gene id: ENSG00000267702
Gene Name: RP11-53B2.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
4175-4195
0.059
2
6mer
323-338
0.004
1
6mer
2902-2925
0.001
2
XLOC_010445
hsa-let-7e-5p
0.962

Gene Details
Chromosome: chr13
Transcript: TCONS_00021851
Biotype: transcript isomorph
Gene id: XLOC_010445
Gene Name: XLOC_010445
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
5721-5740
0.037
2
7mer
5821-5839
0.024
2
6mer
3441-3465
0.001
2
6mer
4159-4182
0.001
2
MIR6818
hsa-let-7e-5p
0.962

Gene Details
Chromosome: 22
Transcript: ENST00000624945
Biotype: antisense
Gene id: ENSG00000279159
Gene Name: MIR6818
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
5411-5424
0.008
4
8mer
48147-48167
0.008
2
6mer
43189-43204
0.004
16
9mer
2773-2798
0.004
2
7mer
16363-16368
0.004
1
6mer
12776-12795
0.003
3
6mer
26618-26644
0.003
4
8mer+wobble
22505-22527
0.002
1
6mer
29086-29104
0.002
5
6mer
10701-10727
0.002
4
6mer
632-651
0.002
4
6mer
27133-27159
0.002
2
6mer
3384-3400
0.002
1
6mer
25071-25095
0.001
5
6mer
20598-20615
0.001
2
6mer
14597-14620
0.001
3
6mer
27323-27336
0.001
3
6mer
25932-25950
0.001
4
6mer
6091-6117
0.001
1
6mer
14018-14041
0.001
2
6mer
6217-6240
0.001
2
6mer
14771-14788
0.001
2
6mer
11068-11091
0.001
1
8mer+wobble
3027-3050
0.001
1
6mer
21295-21309
0.001
1
6mer
6335-6354
0.001
2
6mer
40039-40062
0.001
1
6mer
20847-20870
0.001
2
6mer
45130-45153
0.001
1
6mer
2669-2692
0.001
2
RP11-283C24.1
hsa-let-7e-5p
0.962

Gene Details
Chromosome: 17
Transcript: ENST00000578585
Biotype: lincRNA
Gene id: ENSG00000264215
Gene Name: RP11-283C24.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1108-1122
0.057
1
6mer
165-185
0.007
1
RP4-610C12.3
hsa-let-7e-5p
0.961

Gene Details
Chromosome: 20
Transcript: ENST00000454331
Biotype: lincRNA
Gene id: ENSG00000225490
Gene Name: RP4-610C12.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
524-538
0.063
2
XLOC_013274
hsa-let-7e-5p
0.959

Gene Details
Chromosome: chr19
Transcript: TCONS_00027238
Biotype: transcript isomorph
Gene id: XLOC_013274
Gene Name: XLOC_013274
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
- Liver Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
6422-6437
0.029
1
7mer
138-161
0.021
1
6mer
257-280
0.004
1
6mer
1289-1313
0.003
1
6mer
5976-5999
0.002
1
6mer
6304-6327
0.002
1
6mer
3707-3730
0.002
1
RP11-438B23.2
hsa-let-7e-5p
0.959

Gene Details
Chromosome: 9
Transcript: ENST00000566293
Biotype: sense_overlapping
Gene id: ENSG00000260412
Gene Name: RP11-438B23.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
817-833
0.055
10
6mer
6308-6331
0.005
3
6mer
2446-2465
0.001
Not Conserved
6mer
2361-2380
0.001
5
RP11-142O6.1
hsa-let-7e-5p
0.959

Gene Details
Chromosome: 17
Transcript: ENST00000584382
Biotype: sense_intronic
Gene id: ENSG00000266371
Gene Name: RP11-142O6.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
21-38
0.054
2
6mer
2736-2759
0.008
2
MEG3
hsa-let-7e-5p
0.957

Gene Details
Chromosome: 14
Transcript: ENST00000521404
Biotype: lincRNA
Gene id: ENSG00000214548
Gene Name: MEG3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1341-1363
0.059
6
6mer
174-198
0.003
1
XLOC_003567
hsa-let-7e-5p
0.957

Gene Details
Chromosome: chr4
Transcript: TCONS_00007360
Biotype: transcript isomorph
Gene id: XLOC_003567
Gene Name: XLOC_003567
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
350-370
0.061
2
RP11-718G2.5
hsa-let-7e-5p
0.957

Gene Details
Chromosome: 14
Transcript: ENST00000553791
Biotype: lincRNA
Gene id: ENSG00000259033
Gene Name: RP11-718G2.5
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
263-288
0.044
2
7mer
412-431
0.017
2
TUG1
hsa-let-7e-5p
0.957

Gene Details
Chromosome: 22
Transcript: ENST00000519077
Biotype: antisense
Gene id: ENSG00000253352
Gene Name: TUG1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HREpiC Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
256-280
0.045
10
6mer
897-911
0.004
6
6mer
3690-3711
0.003
9
6mer
1726-1742
0.003
6
6mer
4844-4862
0.003
2
6mer
4917-4943
0.002
2
6mer
4084-4097
0.001
4
6mer
4218-4238
0.001
2
AP001055.6
hsa-let-7e-5p
0.957

Gene Details
Chromosome: 21
Transcript: ENST00000424921
Biotype: lincRNA
Gene id: ENSG00000225331
Gene Name: AP001055.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
109-135
0.061
2
LINC01061
hsa-let-7e-5p
0.957

Gene Details
Chromosome: 4
Transcript: NR_037596.1
Biotype: lincRNA
Gene id: NR_037596.1 (gene)
Gene Name: LINC01061
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
4512-4535
0.027
2
8mer
4608-4626
0.007
1
8mer
1773-1785
0.007
1
8mer+wobble
430-442
0.005
2
8mer+wobble
565-579
0.004
1
6mer
4374-4396
0.003
1
8mer+wobble
3327-3351
0.002
1
6mer
2160-2185
0.002
1
8mer+wobble
1494-1516
0.001
1
8mer+wobble
1252-1276
0.001
1
8mer+wobble
1365-1379
0.001
Not Conserved
LINC00421
hsa-let-7e-5p
0.956

Gene Details
Chromosome: 13
Transcript: ENST00000413833
Biotype: lincRNA
Gene id: ENSG00000236834
Gene Name: LINC00421
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
311-329
0.061
1
XLOC_010290
hsa-let-7e-5p
0.955

Gene Details
Chromosome: chr13
Transcript: TCONS_00021468
Biotype: transcript isomorph
Gene id: XLOC_010290
Gene Name: XLOC_010290
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
- Testes Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
311-329
0.061
1
RP11-91N2.3
hsa-let-7e-5p
0.955

Gene Details
Chromosome: 9
Transcript: ENST00000445631
Biotype: lincRNA
Gene id: ENSG00000231052
Gene Name: RP11-91N2.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
62-85
0.061
2
MEG3
hsa-let-7e-5p
0.955

Gene Details
Chromosome: 14
Transcript: ENST00000451743
Biotype: lincRNA
Gene id: ENSG00000214548
Gene Name: MEG3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1455-1477
0.058
6
6mer
174-198
0.003
1
Funded by: