Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-let-7e-5p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
RP3-522P13.3
hsa-let-7e-5p
0.954

Gene Details
Chromosome: 6
Transcript: ENST00000413898
Biotype: antisense
Gene id: ENSG00000235733
Gene Name: RP3-522P13.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
51-68
0.053
2
9mer
137-152
0.007
1
RP11-131K5.2
hsa-let-7e-5p
0.954

Gene Details
Chromosome: 17
Transcript: ENST00000580134
Biotype: lincRNA
Gene id: ENSG00000265494
Gene Name: RP11-131K5.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1284-1301
0.060
2
RP11-23J9.4
hsa-let-7e-5p
0.954

Gene Details
Chromosome: 9
Transcript: ENST00000529787
Biotype: processed_transcript
Gene id: ENSG00000255036
Gene Name: RP11-23J9.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
105-131
0.049
7
9mer
1444-1456
0.010
4
7mer
4440-4465
0.002
1
AC008067.2
hsa-let-7e-5p
0.953

Gene Details
Chromosome: 2
Transcript: ENST00000599412
Biotype: antisense
Gene id: ENSG00000237031
Gene Name: AC008067.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
174-189
0.060
3
RP11-255A11.2
hsa-let-7e-5p
0.952

Gene Details
Chromosome: 9
Transcript: ENST00000420315
Biotype: antisense
Gene id: ENSG00000228072
Gene Name: RP11-255A11.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
184-208
0.050
1
6mer
38-64
0.010
1
XLOC_009855
hsa-let-7e-5p
0.952

Gene Details
Chromosome: chr12
Transcript: TCONS_00020235
Biotype: transcript isomorph
Gene id: XLOC_009855
Gene Name: XLOC_009855
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Testes Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
886-912
0.052
2
7mer
86-98
0.007
Not Conserved
XLOC_001659
hsa-let-7e-5p
0.951

Gene Details
Chromosome: chr2
Transcript: TCONS_00003851
Biotype: transcript isomorph
Gene id: XLOC_001659
Gene Name: XLOC_001659
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Lung Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
634-659
0.059
4
RP11-119H12.6
hsa-let-7e-5p
0.951

Gene Details
Chromosome: 4
Transcript: ENST00000511590
Biotype: antisense
Gene id: ENSG00000251126
Gene Name: RP11-119H12.6
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
339-356
0.051
3
7mer
212-232
0.008
3
RP11-391M1.4
hsa-let-7e-5p
0.951

Gene Details
Chromosome: 3
Transcript: ENST00000607057
Biotype: lincRNA
Gene id: ENSG00000272452
Gene Name: RP11-391M1.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1216-1237
0.040
1
7mer
454-474
0.015
1
6mer
127-151
0.005
1
MEG3
hsa-let-7e-5p
0.951

Gene Details
Chromosome: 14
Transcript: NR_046465.2
Biotype: lincRNA
Gene id: NR_046465.2 (gene)
Gene Name: MEG3
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1511-1533
0.057
6
6mer
192-216
0.002
1
MEG3
hsa-let-7e-5p
0.951

Gene Details
Chromosome: 14
Transcript: NR_002766.2
Biotype: lincRNA
Gene id: NR_002766.2 (gene)
Gene Name: MEG3
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1473-1495
0.057
6
6mer
192-216
0.002
1
RP11-266K4.13
hsa-let-7e-5p
0.950

Gene Details
Chromosome: 12
Transcript: ENST00000611627
Biotype: lincRNA
Gene id: ENSG00000276417
Gene Name: RP11-266K4.13
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1267-1280
0.059
2
MEG3
hsa-let-7e-5p
0.950

Gene Details
Chromosome: 14
Transcript: NR_046471.1
Biotype: lincRNA
Gene id: NR_046471.1 (gene)
Gene Name: MEG3
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1397-1419
0.057
6
6mer
192-216
0.002
1
XLOC_000307
hsa-let-7e-5p
0.949

Gene Details
Chromosome: chr1
Transcript: TCONS_00001046
Biotype: transcript isomorph
Gene id: XLOC_000307
Gene Name: XLOC_000307
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
- Heart Normal/Primary
- Liver Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1120-1138
0.035
2
7mer
1089-1109
0.016
3
6mer
311-333
0.008
8
ST3GAL5-AS1
hsa-let-7e-5p
0.948

Gene Details
Chromosome: 2
Transcript: ENST00000455121
Biotype: lincRNA
Gene id: ENSG00000232504
Gene Name: ST3GAL5-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
672-692
0.058
2
AC006548.28
hsa-let-7e-5p
0.947

Gene Details
Chromosome: 22
Transcript: ENST00000623130
Biotype: sense_overlapping
Gene id: ENSG00000280156
Gene Name: AC006548.28
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
69489-69505
0.013
1
7mer
73810-73826
0.005
1
7mer
7399-7422
0.004
1
8mer
14595-14615
0.004
1
6mer
521-538
0.003
1
7mer
68517-68531
0.003
1
8mer+wobble
65474-65487
0.003
2
6mer
68523-68546
0.002
1
6mer
59600-59625
0.002
2
8mer+wobble
82885-82897
0.001
2
6mer
34390-34415
0.001
2
6mer
54160-54176
0.001
Not Conserved
6mer
77607-77628
0.001
1
6mer
83225-83238
0.001
2
6mer
38575-38596
0.001
4
6mer
20245-20259
0.001
4
6mer
3430-3444
0.001
1
6mer
57401-57423
0.001
2
6mer
17488-17508
0.001
2
6mer
22965-22985
0.001
2
6mer
62769-62791
0.001
1
6mer
9995-10021
0.001
2
6mer
15715-15731
0.001
3
6mer
13264-13285
0.001
1
8mer+wobble
81926-81939
0.001
Not Conserved
6mer
16076-16092
0.001
1
6mer
8895-8909
0.001
Not Conserved
6mer
15591-15612
0.001
1
8mer+wobble
20168-20191
0.000
2
6mer
17418-17445
0.000
1
XLOC_001373
hsa-let-7e-5p
0.946

Gene Details
Chromosome: chr2
Transcript: TCONS_00003589
Biotype: transcript isomorph
Gene id: XLOC_001373
Gene Name: XLOC_001373
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Brain Normal/Primary
- Colon Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
90-110
0.057
1
XLOC_011696
hsa-let-7e-5p
0.945

Gene Details
Chromosome: chr16
Transcript: TCONS_00024372
Biotype: transcript isomorph
Gene id: XLOC_011696
Gene Name: XLOC_011696
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Kidney Normal/Primary
- Ovary Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
613-627
0.045
1
6mer
1047-1064
0.008
1
6mer
1659-1676
0.004
Not Conserved
MEG3
hsa-let-7e-5p
0.944

Gene Details
Chromosome: 14
Transcript: ENST00000555928
Biotype: lincRNA
Gene id: ENSG00000214548
Gene Name: MEG3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
598-620
0.057
6
LINC00221
hsa-let-7e-5p
0.944

Gene Details
Chromosome: 14
Transcript: ENST00000619530
Biotype: lincRNA
Gene id: ENSG00000270816
Gene Name: LINC00221
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1337-1353
0.029
2
7mer
1242-1267
0.023
2
6mer
1206-1226
0.005
1
Funded by: