Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-let-7e-5p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
CTA-941F9.10
hsa-let-7e-5p
0.941

Gene Details
Chromosome: 22
Transcript: ENST00000623075
Biotype: sense_overlapping
Gene id: ENSG00000280383
Gene Name: CTA-941F9.10
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
5231-5256
0.010
2
7mer
682-708
0.010
Not Conserved
7mer
12455-12478
0.005
1
7mer
20177-20193
0.005
3
7mer
16364-16383
0.003
2
8mer+wobble
19856-19877
0.003
1
6mer
22173-22193
0.003
3
6mer
8983-9005
0.002
2
6mer
4316-4333
0.002
1
6mer
12158-12179
0.002
2
6mer
10403-10422
0.001
1
6mer
16027-16040
0.001
2
8mer+wobble
19211-19226
0.001
2
6mer
3004-3027
0.001
1
6mer
18634-18659
0.001
1
6mer
9746-9763
0.001
3
6mer
7974-7997
0.001
1
6mer
10243-10257
0.001
2
6mer
13063-13086
0.001
2
6mer
2297-2320
0.001
1
6mer
11177-11200
0.001
2
8mer+wobble
11192-11217
0.000
2
AP001055.6
hsa-let-7e-5p
0.941

Gene Details
Chromosome: 21
Transcript: ENST00000411694
Biotype: lincRNA
Gene id: ENSG00000225331
Gene Name: AP001055.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
384-410
0.056
2
XLOC_006460
hsa-let-7e-5p
0.939

Gene Details
Chromosome: chr7
Transcript: TCONS_00013820
Biotype: transcript isomorph
Gene id: XLOC_006460
Gene Name: XLOC_006460
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1473-1491
0.014
1
XLOC_013018
hsa-let-7e-5p
0.939

Gene Details
Chromosome: chr19
Transcript: TCONS_00026966
Biotype: transcript isomorph
Gene id: XLOC_013018
Gene Name: XLOC_013018
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
- Kidney Normal/Primary
Fibroblasts Lung Normal/Primary
- Ovary Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
24-50
0.052
2
6mer
311-331
0.003
Not Conserved
XLOC_014347
hsa-let-7e-5p
0.938

Gene Details
Chromosome: chr22
Transcript: TCONS_00029677
Biotype: transcript isomorph
Gene id: XLOC_014347
Gene Name: XLOC_014347
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Heart Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
126-144
0.055
6
ZNRD1-AS1
hsa-let-7e-5p
0.938

Gene Details
Chromosome: 6
Transcript: ENST00000431012
Biotype: antisense
Gene id: ENSG00000204623
Gene Name: ZNRD1-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
365-387
0.055
1
RP11-325F22.5
hsa-let-7e-5p
0.936

Gene Details
Chromosome: 7
Transcript: ENST00000453666
Biotype: lincRNA
Gene id: ENSG00000225329
Gene Name: RP11-325F22.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
520-531
0.038
3
7mer
133-153
0.017
2
RP11-20J15.2
hsa-let-7e-5p
0.934

Gene Details
Chromosome: 10
Transcript: ENST00000437014
Biotype: lincRNA
Gene id: ENSG00000237590
Gene Name: RP11-20J15.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
448-467
0.054
2
AC104655.3
hsa-let-7e-5p
0.933

Gene Details
Chromosome: 2
Transcript: ENST00000452037
Biotype: lincRNA
Gene id: ENSG00000226508
Gene Name: AC104655.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
377-391
0.054
2
XLOC_004611
hsa-let-7e-5p
0.933

Gene Details
Chromosome: chr5
Transcript: TCONS_00010144
Biotype: transcript isomorph
Gene id: XLOC_004611
Gene Name: XLOC_004611
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
756-781
0.034
1
8mer+wobble
32-48
0.020
1
MEG3
hsa-let-7e-5p
0.932

Gene Details
Chromosome: 14
Transcript: ENST00000423456
Biotype: lincRNA
Gene id: ENSG00000214548
Gene Name: MEG3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1705-1727
0.051
6
6mer
174-198
0.003
1
AC002480.4
hsa-let-7e-5p
0.932

Gene Details
Chromosome: 7
Transcript: ENST00000439823
Biotype: antisense
Gene id: ENSG00000232949
Gene Name: AC002480.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
32-52
0.037
3
8mer
504-521
0.017
Not Conserved
RP11-180P8.3
hsa-let-7e-5p
0.932

Gene Details
Chromosome: 17
Transcript: ENST00000581596
Biotype: lincRNA
Gene id: ENSG00000266411
Gene Name: RP11-180P8.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
487-508
0.053
1
RP11-834C11.4
hsa-let-7e-5p
0.930

Gene Details
Chromosome: 12
Transcript: ENST00000508564
Biotype: lincRNA
Gene id: ENSG00000250742
Gene Name: RP11-834C11.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HREpiC Kidney Normal/Primary
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1251-1275
0.049
5
8mer+mismatch
985-1001
0.004
3
RP11-542G1.2
hsa-let-7e-5p
0.928

Gene Details
Chromosome: 4
Transcript: ENST00000509215
Biotype: lincRNA
Gene id: ENSG00000251454
Gene Name: RP11-542G1.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
91-108
0.053
1
RP11-458F8.4
hsa-let-7e-5p
0.928

Gene Details
Chromosome: 7
Transcript: ENST00000610177
Biotype: lincRNA
Gene id: ENSG00000273142
Gene Name: RP11-458F8.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer+wobble
3139-3153
0.019
1
7mer
2773-2796
0.008
1
8mer+wobble
2305-2325
0.004
2
6mer
91-108
0.004
1
8mer
718-745
0.004
Not Conserved
6mer
2872-2891
0.004
2
6mer
2460-2478
0.003
2
8mer+wobble
2242-2257
0.003
1
6mer
2136-2162
0.002
1
8mer+wobble
922-945
0.001
1
8mer+wobble
1339-1364
0.001
Not Conserved
CYP4F26P
hsa-let-7e-5p
0.927

Gene Details
Chromosome: 9
Transcript: ENST00000602933
Biotype: lincRNA
Gene id: ENSG00000226562
Gene Name: CYP4F26P
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
19-45
0.052
1
CDKN2B-AS1
hsa-let-7e-5p
0.924

Gene Details
Chromosome: 9
Transcript: ENST00000584351
Biotype: antisense
Gene id: ENSG00000240498
Gene Name: CDKN2B-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
hMSC-BM Bone Marrow Stem/Progenitor
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
2287-2301
0.046
3
6mer
1617-1637
0.004
3
6mer
2011-2032
0.002
1
TUG1
hsa-let-7e-5p
0.922

Gene Details
Chromosome: 22
Transcript: ENST00000540687
Biotype: antisense
Gene id: ENSG00000253352
Gene Name: TUG1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HREpiC Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
645-669
0.038
10
6mer
2129-2145
0.006
6
6mer
202-218
0.005
5
6mer
1286-1300
0.003
6
MEG3
hsa-let-7e-5p
0.922

Gene Details
Chromosome: 14
Transcript: ENST00000412736
Biotype: lincRNA
Gene id: ENSG00000214548
Gene Name: MEG3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1542-1564
0.048
6
6mer
152-176
0.003
1
Funded by: