Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-let-7e-5p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
LCMT1-AS2
hsa-let-7e-5p
0.922

Gene Details
Chromosome: 16
Transcript: ENST00000565214
Biotype: antisense
Gene id: ENSG00000260034
Gene Name: LCMT1-AS2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
100-124
0.022
1
6mer
5188-5214
0.012
2
6mer
1798-1823
0.004
2
8mer+mismatch
2127-2148
0.004
2
6mer
3963-3983
0.004
2
6mer
2251-2272
0.002
1
6mer
1633-1644
0.002
1
RP11-88I18.2
hsa-let-7e-5p
0.921

Gene Details
Chromosome: 9
Transcript: ENST00000590767
Biotype: antisense
Gene id: ENSG00000233178
Gene Name: RP11-88I18.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
A549 Lung Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
492-499
0.027
Not Conserved
7mer
483-502
0.015
2
6mer
142-163
0.005
2
6mer
1567-1577
0.004
4
6mer
1543-1570
0.001
1
MEG3
hsa-let-7e-5p
0.921

Gene Details
Chromosome: 14
Transcript: ENST00000398518
Biotype: lincRNA
Gene id: ENSG00000214548
Gene Name: MEG3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1584-1606
0.048
6
6mer
173-197
0.003
1
CTD-2227C6.2
hsa-let-7e-5p
0.920

Gene Details
Chromosome: 5
Transcript: ENST00000514840
Biotype: lincRNA
Gene id: ENSG00000249664
Gene Name: CTD-2227C6.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
491-508
0.051
1
RP11-22A3.2
hsa-let-7e-5p
0.920

Gene Details
Chromosome: 4
Transcript: ENST00000506899
Biotype: lincRNA
Gene id: ENSG00000250371
Gene Name: RP11-22A3.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Ovary Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
2482-2509
0.047
3
6mer
245-266
0.004
1
MEG3
hsa-let-7e-5p
0.920

Gene Details
Chromosome: 14
Transcript: ENST00000519709
Biotype: lincRNA
Gene id: ENSG00000214548
Gene Name: MEG3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1622-1644
0.048
6
6mer
166-190
0.003
1
MEG3
hsa-let-7e-5p
0.919

Gene Details
Chromosome: 14
Transcript: ENST00000524035
Biotype: lincRNA
Gene id: ENSG00000214548
Gene Name: MEG3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
2736-2758
0.047
6
8mer+wobble
1793-1818
0.003
2
MEG3
hsa-let-7e-5p
0.919

Gene Details
Chromosome: 14
Transcript: ENST00000556736
Biotype: lincRNA
Gene id: ENSG00000214548
Gene Name: MEG3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1585-1607
0.048
6
6mer
174-198
0.003
1
TUG1
hsa-let-7e-5p
0.919

Gene Details
Chromosome: 22
Transcript: ENST00000566220
Biotype: antisense
Gene id: ENSG00000253352
Gene Name: TUG1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HREpiC Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
274-298
0.045
10
6mer
846-860
0.006
6
RP11-304L19.2
hsa-let-7e-5p
0.919

Gene Details
Chromosome: 16
Transcript: ENST00000562027
Biotype: antisense
Gene id: ENSG00000260447
Gene Name: RP11-304L19.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
572-590
0.050
1
LOC100240735
hsa-let-7e-5p
0.918

Gene Details
Chromosome: 12
Transcript: NR_026658.1
Biotype: lincRNA
Gene id: NR_026658.1 (gene)
Gene Name: LOC100240735
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
614-627
0.050
3
XLOC_003574
hsa-let-7e-5p
0.917

Gene Details
Chromosome: chr4
Transcript: TCONS_00008108
Biotype: transcript isomorph
Gene id: XLOC_003574
Gene Name: XLOC_003574
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
869-882
0.048
2
6mer
460-476
0.002
Not Conserved
RP11-105C19.2
hsa-let-7e-5p
0.916

Gene Details
Chromosome: 16
Transcript: ENST00000567401
Biotype: lincRNA
Gene id: ENSG00000260973
Gene Name: RP11-105C19.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
935-958
0.041
4
7mer
339-361
0.009
2
MEG3
hsa-let-7e-5p
0.916

Gene Details
Chromosome: 14
Transcript: ENST00000554639
Biotype: lincRNA
Gene id: ENSG00000214548
Gene Name: MEG3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1590-1612
0.047
6
6mer
168-192
0.003
1
RP11-645C24.5
hsa-let-7e-5p
0.915

Gene Details
Chromosome: 16
Transcript: ENST00000567370
Biotype: lincRNA
Gene id: ENSG00000260306
Gene Name: RP11-645C24.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
934-957
0.042
3
7mer
339-361
0.008
1
MEG3
hsa-let-7e-5p
0.914

Gene Details
Chromosome: 14
Transcript: ENST00000429159
Biotype: lincRNA
Gene id: ENSG00000214548
Gene Name: MEG3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1489-1511
0.047
6
6mer
192-216
0.002
1
LL22NC03-2H8.5
hsa-let-7e-5p
0.914

Gene Details
Chromosome: 22
Transcript: ENST00000610778
Biotype: lincRNA
Gene id: ENSG00000274422
Gene Name: LL22NC03-2H8.5
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
335-349
0.031
1
6mer
546-572
0.012
2
6mer
384-394
0.006
1
MEG3
hsa-let-7e-5p
0.914

Gene Details
Chromosome: 14
Transcript: NR_046467.1
Biotype: lincRNA
Gene id: NR_046467.1 (gene)
Gene Name: MEG3
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1641-1663
0.047
6
6mer
192-216
0.002
1
MEG3
hsa-let-7e-5p
0.913

Gene Details
Chromosome: 14
Transcript: NR_046464.1
Biotype: lincRNA
Gene id: NR_046464.1 (gene)
Gene Name: MEG3
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1537-1559
0.047
6
6mer
192-216
0.002
1
MEG3
hsa-let-7e-5p
0.912

Gene Details
Chromosome: 14
Transcript: NR_046472.1
Biotype: lincRNA
Gene id: NR_046472.1 (gene)
Gene Name: MEG3
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1527-1549
0.047
6
6mer
192-216
0.002
1
Funded by: