Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-let-7e-5p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
XLOC_012997
hsa-let-7e-5p
0.912

Gene Details
Chromosome: chr19
Transcript: TCONS_00026934
Biotype: transcript isomorph
Gene id: XLOC_012997
Gene Name: XLOC_012997
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
- Liver Normal/Primary
A549 Lung Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
583-603
0.046
2
6mer
810-831
0.003
1
MEG3
hsa-let-7e-5p
0.912

Gene Details
Chromosome: 14
Transcript: NR_046469.1
Biotype: lincRNA
Gene id: NR_046469.1 (gene)
Gene Name: MEG3
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1503-1525
0.047
6
6mer
192-216
0.002
1
RP11-309L24.4
hsa-let-7e-5p
0.909

Gene Details
Chromosome: 7
Transcript: ENST00000609480
Biotype: lincRNA
Gene id: ENSG00000272899
Gene Name: RP11-309L24.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
147-173
0.040
7
6mer
185-211
0.005
9
8mer+mismatch
2838-2855
0.001
1
6mer
2705-2726
0.001
1
6mer
1523-1545
0.001
1
RP11-932O9.9
hsa-let-7e-5p
0.909

Gene Details
Chromosome: 15
Transcript: ENST00000602594
Biotype: lincRNA
Gene id: ENSG00000269930
Gene Name: RP11-932O9.9
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
128-149
0.048
2
RP11-504P24.8
hsa-let-7e-5p
0.909

Gene Details
Chromosome: 1
Transcript: ENST00000608760
Biotype: lincRNA
Gene id: ENSG00000272645
Gene Name: RP11-504P24.8
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
800-823
0.028
2
8mer
896-913
0.006
1
8mer+wobble
415-429
0.005
1
6mer
662-684
0.004
2
6mer
1473-1498
0.004
2
8mer+wobble
302-314
0.002
Not Conserved
NEAT1
hsa-let-7e-5p
0.908

Gene Details
Chromosome: 11
Transcript: ENST00000501122
Biotype: lincRNA
Gene id: ENSG00000245532
Gene Name: NEAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
14736-14756
0.019
3
7mer
11331-11353
0.005
2
7mer
20862-20886
0.005
3
7mer
13319-13341
0.005
3
7mer
4180-4201
0.004
1
7mer
13410-13432
0.003
2
7mer
14915-14938
0.002
Not Conserved
6mer
22084-22103
0.002
3
6mer
4392-4408
0.002
2
8mer+wobble
7389-7414
0.001
1
MEG3
hsa-let-7e-5p
0.908

Gene Details
Chromosome: 14
Transcript: ENST00000522618
Biotype: lincRNA
Gene id: ENSG00000214548
Gene Name: MEG3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
871-893
0.048
6
CTC-338M12.4
hsa-let-7e-5p
0.908

Gene Details
Chromosome: 5
Transcript: ENST00000599439
Biotype: retained_intron
Gene id: ENSG00000233937
Gene Name: CTC-338M12.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1193-1214
0.038
3
6mer
1581-1594
0.010
4
RP11-506B6.6
hsa-let-7e-5p
0.907

Gene Details
Chromosome: 6
Transcript: ENST00000590293
Biotype: antisense
Gene id: ENSG00000226440
Gene Name: RP11-506B6.6
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
410-423
0.033
3
8mer+wobble
170-186
0.011
2
6mer
249-271
0.004
3
LMCD1-AS1
hsa-let-7e-5p
0.905

Gene Details
Chromosome: 3
Transcript: ENST00000420095
Biotype: antisense
Gene id: ENSG00000227110
Gene Name: LMCD1-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
959-978
0.047
2
MEG3
hsa-let-7e-5p
0.904

Gene Details
Chromosome: 14
Transcript: ENST00000398474
Biotype: lincRNA
Gene id: ENSG00000214548
Gene Name: MEG3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1604-1626
0.047
6
RP6-91H8.1
hsa-let-7e-5p
0.904

Gene Details
Chromosome: 14
Transcript: ENST00000553621
Biotype: lincRNA
Gene id: ENSG00000258517
Gene Name: RP6-91H8.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
483-507
0.047
2
AC005537.2
hsa-let-7e-5p
0.904

Gene Details
Chromosome: 7
Transcript: ENST00000585996
Biotype: lincRNA
Gene id: ENSG00000232006
Gene Name: AC005537.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
236-252
0.047
1
RP11-780O24.2
hsa-let-7e-5p
0.904

Gene Details
Chromosome: 11
Transcript: ENST00000531918
Biotype: antisense
Gene id: ENSG00000255523
Gene Name: RP11-780O24.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
484-502
0.047
1
CTB-39G8.3
hsa-let-7e-5p
0.903

Gene Details
Chromosome: 17
Transcript: ENST00000592389
Biotype: antisense
Gene id: ENSG00000267344
Gene Name: CTB-39G8.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
409-428
0.047
5
MIR4534
hsa-let-7e-5p
0.903

Gene Details
Chromosome: 22
Transcript: ENST00000623111
Biotype: sense_overlapping
Gene id: ENSG00000279010
Gene Name: MIR4534
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
39459-39478
0.005
2
8mer+wobble
8937-8951
0.004
1
7mer
4752-4776
0.004
2
7mer
28347-28369
0.004
1
7mer
32095-32103
0.004
1
7mer
46583-46608
0.003
1
8mer+wobble
41449-41474
0.002
1
8mer+wobble
49160-49186
0.002
2
6mer
25680-25695
0.002
5
8mer+mismatch
10260-10282
0.001
1
6mer
19636-19658
0.001
8
8mer+wobble
24401-24415
0.001
1
6mer
53392-53415
0.001
2
6mer
46938-46962
0.001
2
6mer
7544-7567
0.001
2
6mer
50106-50131
0.001
2
6mer
12264-12285
0.001
1
6mer
1971-1994
0.001
1
8mer+wobble
11942-11962
0.001
Not Conserved
6mer
49430-49449
0.001
2
6mer
16432-16455
0.001
2
6mer
26213-26235
0.001
3
6mer
3509-3533
0.001
1
6mer
44258-44281
0.001
1
8mer+mismatch
42862-42881
0.001
1
6mer
33060-33087
0.001
2
6mer
16866-16889
0.001
2
6mer
30957-30980
0.001
2
6mer
42978-43001
0.000
2
XLOC_004879
hsa-let-7e-5p
0.902

Gene Details
Chromosome: chr5
Transcript: TCONS_00010376
Biotype: transcript isomorph
Gene id: XLOC_004879
Gene Name: XLOC_004879
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
- Colon Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
326-341
0.036
2
8mer
1051-1067
0.011
2
AC073957.15
hsa-let-7e-5p
0.901

Gene Details
Chromosome: 7
Transcript: ENST00000418941
Biotype: antisense
Gene id: ENSG00000225146
Gene Name: AC073957.15
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
73-91
0.047
1
LHFPL3-AS2
hsa-let-7e-5p
0.898

Gene Details
Chromosome: 7
Transcript: NR_027374.1
Biotype: antisense
Gene id: NR_027374.1 (gene)
Gene Name: LHFPL3-AS2
UCSC graphic: -
Expression:
  Cell Line Tissue Category
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1697-1708
0.038
3
8mer
862-878
0.008
1
AC104777.3
hsa-let-7e-5p
0.897

Gene Details
Chromosome: 2
Transcript: ENST00000416350
Biotype: lincRNA
Gene id: ENSG00000237220
Gene Name: AC104777.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
77-102
0.046
1
Funded by: