Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-let-7e-5p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
LINC00665
hsa-let-7e-5p
0.897

Gene Details
Chromosome: 19
Transcript: ENST00000590657
Biotype: lincRNA
Gene id: ENSG00000232677
Gene Name: LINC00665
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer+wobble
1656-1678
0.016
2
7mer
1920-1937
0.011
1
6mer
472-494
0.009
2
6mer
2434-2454
0.007
1
6mer
1206-1229
0.002
1
XLOC_000647
hsa-let-7e-5p
0.895

Gene Details
Chromosome: chr1
Transcript: TCONS_00002272
Biotype: transcript isomorph
Gene id: XLOC_000647
Gene Name: XLOC_000647
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
HREpiC Kidney Normal/Primary
- Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
Fibroblasts Lung Normal/Primary
- Lung Normal/Primary
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
917-940
0.026
1
7mer
878-899
0.011
1
7mer
1053-1070
0.006
1
6mer
848-873
0.002
2
MEG3
hsa-let-7e-5p
0.894

Gene Details
Chromosome: 14
Transcript: ENST00000398461
Biotype: lincRNA
Gene id: ENSG00000214548
Gene Name: MEG3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
3335-3357
0.040
6
8mer+wobble
2588-2613
0.004
2
6mer
502-525
0.002
1
LL22NC03-22D1.1
hsa-let-7e-5p
0.894

Gene Details
Chromosome: 22
Transcript: ENST00000624601
Biotype: lincRNA
Gene id: ENSG00000279003
Gene Name: LL22NC03-22D1.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
26559-26573
0.018
2
7mer
28229-28256
0.011
1
6mer
18454-18475
0.003
3
8mer+wobble
24631-24654
0.002
1
8mer
27411-27436
0.002
1
6mer
3581-3598
0.002
2
6mer
11705-11726
0.002
1
6mer
12342-12355
0.002
2
6mer
17694-17718
0.001
2
6mer
3948-3965
0.001
2
6mer
24250-24267
0.001
1
6mer
24704-24719
0.001
1
HOXA10-HOXA9
hsa-let-7e-5p
0.892

Gene Details
Chromosome: 7
Transcript: NR_037940.1
Biotype: sense
Gene id: NR_037940.1 (gene)
Gene Name: HOXA10-HOXA9
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
77-102
0.030
11
7mer
1292-1309
0.013
8
6mer
1250-1272
0.002
9
6mer
1030-1044
0.001
2
AC104655.3
hsa-let-7e-5p
0.892

Gene Details
Chromosome: 2
Transcript: ENST00000436841
Biotype: lincRNA
Gene id: ENSG00000226508
Gene Name: AC104655.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
349-363
0.045
2
CTB-119C2.1
hsa-let-7e-5p
0.891

Gene Details
Chromosome: 7
Transcript: ENST00000608362
Biotype: antisense
Gene id: ENSG00000273237
Gene Name: CTB-119C2.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
652-666
0.035
3
6mer
78-96
0.006
2
6mer
669-694
0.004
2
RP1-68D18.3
hsa-let-7e-5p
0.889

Gene Details
Chromosome: 11
Transcript: ENST00000532760
Biotype: antisense
Gene id: ENSG00000255004
Gene Name: RP1-68D18.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
194-216
0.045
2
XLOC_009544
hsa-let-7e-5p
0.888

Gene Details
Chromosome: chr11
Transcript: TCONS_00019750
Biotype: transcript isomorph
Gene id: XLOC_009544
Gene Name: XLOC_009544
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
- Liver Normal/Primary
Fibroblasts Lung Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
3120-3142
0.032
1
7mer
288-310
0.012
1
XLOC_007118
hsa-let-7e-5p
0.886

Gene Details
Chromosome: chr8
Transcript: TCONS_00015037
Biotype: transcript isomorph
Gene id: XLOC_007118
Gene Name: XLOC_007118
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Kidney Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
4196-4216
0.014
2
6mer
647-668
0.005
1
6mer
3580-3595
0.005
1
6mer
3834-3858
0.004
1
6mer
1186-1207
0.004
1
6mer
990-1004
0.004
1
6mer
3338-3362
0.003
1
6mer
2804-2819
0.002
1
6mer
793-817
0.002
Not Conserved
6mer
2128-2152
0.001
Not Conserved
CTD-3064H18.1
hsa-let-7e-5p
0.886

Gene Details
Chromosome: 19
Transcript: ENST00000587060
Biotype: antisense
Gene id: ENSG00000266916
Gene Name: CTD-3064H18.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
135-157
0.038
3
6mer
161-182
0.006
3
KB-1552D7.2
hsa-let-7e-5p
0.884

Gene Details
Chromosome: 8
Transcript: ENST00000622091
Biotype: sense_intronic
Gene id: ENSG00000179577
Gene Name: KB-1552D7.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1483-1500
0.039
4
6mer
763-781
0.004
7
HCG18
hsa-let-7e-5p
0.884

Gene Details
Chromosome: 6
Transcript: ENST00000602516
Biotype: antisense
Gene id: ENSG00000231074
Gene Name: HCG18
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
274-293
0.024
2
7mer
100-117
0.020
2
KB-1552D7.2
hsa-let-7e-5p
0.884

Gene Details
Chromosome: 8
Transcript: ENST00000319051
Biotype: pseudogene
Gene id: ENSG00000179577
Gene Name: KB-1552D7.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1482-1499
0.039
4
6mer
763-781
0.004
7
XLOC_001548
hsa-let-7e-5p
0.883

Gene Details
Chromosome: chr2
Transcript: TCONS_00003750
Biotype: transcript isomorph
Gene id: XLOC_001548
Gene Name: XLOC_001548
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
460-486
0.044
2
DSCR8
hsa-let-7e-5p
0.883

Gene Details
Chromosome: 21
Transcript: NR_026839.1
Biotype: sense
Gene id: NR_026839.1 (gene)
Gene Name: DSCR8
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
690-715
0.044
6
RP11-351I21.11
hsa-let-7e-5p
0.882

Gene Details
Chromosome: 8
Transcript: ENST00000602981
Biotype: lincRNA
Gene id: ENSG00000270074
Gene Name: RP11-351I21.11
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
131-151
0.044
1
XLOC_001711
hsa-let-7e-5p
0.882

Gene Details
Chromosome: chr2
Transcript: TCONS_00003906
Biotype: transcript isomorph
Gene id: XLOC_001711
Gene Name: XLOC_001711
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
107-130
0.044
2
DSCR8
hsa-let-7e-5p
0.880

Gene Details
Chromosome: 21
Transcript: NR_026842.1
Biotype: sense
Gene id: NR_026842.1 (gene)
Gene Name: DSCR8
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
433-458
0.043
6
RP11-103C16.2
hsa-let-7e-5p
0.880

Gene Details
Chromosome: 6
Transcript: ENST00000417390
Biotype: antisense
Gene id: ENSG00000227945
Gene Name: RP11-103C16.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
291-315
0.043
15
Funded by: