Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-187-3p

ENST00000458178
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
LL22NC03-86G7.1
hsa-miR-187-3p
0.646

Gene Details
Chromosome: 22
Transcript: ENST00000458178
Biotype: antisense
Gene id: ENSG00000224086
Gene Name: LL22NC03-86G7.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant


miRNA Details
Name: hsa-miR-187-3p
Sequence: ucgugucuuguguugcagccgg
MirBase ID: MIMAT0000262
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
36885-36902
0.007
1
8mer
22882-22905
0.005
1
7mer
30984-31006
0.003
1
6mer
13852-13857
0.002
1
6mer
17178-17203
0.001
1
6mer
28914-28930
0.001
5
6mer
3415-3429
0.001
1
6mer
2972-2992
0.001
2
Funded by: