Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-187-3p

NR_046173.1
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
LOC254896
hsa-miR-187-3p
0.362

Gene Details
Chromosome: 8
Transcript: NR_046173.1
Biotype: sense
Gene id: NR_046173.1 (gene)
Gene Name: LOC254896
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-187-3p
Sequence: ucgugucuuguguugcagccgg
MirBase ID: MIMAT0000262
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
921-940
0.001
1
Funded by: