Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-187-3p

TCONS_00028507
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
XLOC_013473
hsa-miR-187-3p
0.726

Gene Details
Chromosome: chr20
Transcript: TCONS_00028507
Biotype: transcript isomorph
Gene id: XLOC_013473
Gene Name: XLOC_013473
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
Fibroblasts Lung Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-187-3p
Sequence: ucgugucuuguguugcagccgg
MirBase ID: MIMAT0000262
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
300-318
0.020
1
7mer
704-726
0.006
1
Funded by: