Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-3615

ENST00000422718
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
ADIPOQ-AS1
hsa-miR-3615
0.540

Gene Details
Chromosome: 3
Transcript: ENST00000422718
Biotype: antisense
Gene id: ENSG00000226482
Gene Name: ADIPOQ-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
533-555
0.004
1
6mer
579-595
0.002
2
6mer
577-595
0.002
2
6mer
1131-1147
0.001
2
6mer
575-591
0.001
2
6mer
563-583
0.001
2
6mer
2286-2309
0.001
1
Funded by: