Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-3615

ENST00000564464
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
CTA-204B4.2
hsa-miR-3615
0.472

Gene Details
Chromosome: 8
Transcript: ENST00000564464
Biotype: antisense
Gene id: ENSG00000259891
Gene Name: CTA-204B4.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
2148-2163
0.004
1
6mer
2150-2163
0.003
1
6mer
761-776
0.002
1
Funded by: