Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-3615

ENST00000623644
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
chr22-38_28785274-29006793.1
hsa-miR-3615
1.000

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
224601-224622
0.010
2
9mer
46975-46996
0.007
2
7mer
144956-144978
0.004
4
7mer
12377-12388
0.003
1
6mer
59789-59794
0.003
7
7mer
200960-200976
0.002
1
6mer
81284-81298
0.002
5
6mer
130324-130345
0.002
2
6mer
238447-238451
0.002
1
6mer
13188-13206
0.002
7
6mer
186469-186490
0.002
Not Conserved
6mer
148207-148216
0.002
7
6mer
115984-116004
0.002
7
7mer
237227-237241
0.002
Not Conserved
6mer
229517-229535
0.002
2
6mer
153001-153025
0.002
2
7mer
142627-142650
0.002
1
6mer
60074-60087
0.002
1
6mer
124900-124925
0.002
6
6mer
248508-248526
0.002
1
6mer
163401-163415
0.001
5
6mer
32270-32292
0.001
3
6mer
70760-70779
0.001
2
6mer
16147-16172
0.001
1
6mer
212110-212130
0.001
5
6mer
7532-7559
0.001
4
7mer
118612-118635
0.001
1
6mer
230778-230801
0.001
1
6mer
81991-82008
0.001
1
6mer
108750-108771
0.001
1
6mer
16850-16869
0.001
2
6mer
240566-240592
0.001
1
6mer
241218-241237
0.001
1
6mer
162901-162917
0.001
5
6mer
102713-102740
0.001
2
6mer
106078-106102
0.001
3
6mer
148501-148523
0.001
4
6mer
206969-206983
0.001
1
6mer
35710-35723
0.001
3
6mer
168513-168526
0.001
3
6mer
98398-98416
0.001
3
6mer
140131-140151
0.001
4
6mer
49799-49821
0.001
1
6mer
255615-255631
0.001
3
6mer
159724-159744
0.001
2
6mer
140331-140350
0.001
1
8mer+wobble
116581-116599
0.001
6
6mer
161884-161901
0.001
Not Conserved
6mer
124772-124786
0.001
2
6mer
103908-103916
0.001
1
6mer
233556-233581
0.001
1
6mer
144071-144091
0.001
1
6mer
185407-185434
0.001
2
6mer
75504-75527
0.001
2
6mer
85604-85619
0.001
1
6mer
234092-234113
0.001
2
6mer
62955-62982
0.001
1
6mer
28434-28448
0.001
2
6mer
61052-61069
0.001
2
6mer
116257-116284
0.001
2
6mer
75175-75195
0.001
2
6mer
88387-88407
0.001
1
6mer
204168-204195
0.001
2
6mer
88093-88110
0.001
3
6mer
145046-145071
0.001
6
6mer
88477-88497
0.001
2
6mer
165991-166018
0.001
2
6mer
161958-161980
0.001
3
6mer
236102-236118
0.001
1
6mer
217553-217570
0.001
3
6mer
251887-251904
0.001
1
6mer
63230-63256
0.001
1
6mer
180084-180105
0.001
2
8mer+mismatch
4553-4569
0.001
2
6mer
58035-58062
0.001
3
6mer
246884-246909
0.001
1
6mer
2178-2196
0.001
1
6mer
195380-195402
0.001
1
6mer
254401-254428
0.001
3
6mer
239907-239930
0.001
2
6mer
124918-124927
0.001
7
6mer
52760-52782
0.001
3
6mer
162039-162055
0.001
2
6mer
99570-99595
0.001
2
6mer
141117-141142
0.001
1
6mer
188381-188393
0.001
1
6mer
257542-257559
0.001
1
6mer
53060-53077
0.001
2
6mer
249804-249823
0.001
Not Conserved
6mer
32270-32294
0.001
3
6mer
114524-114544
0.001
1
6mer
35710-35727
0.001
2
6mer
102715-102742
0.001
2
6mer
108766-108773
0.001
1
6mer
35710-35725
0.001
3
6mer
212116-212132
0.000
5
6mer
88108-88134
0.000
2
6mer
200968-200978
0.000
1
6mer
254864-254887
0.000
1
6mer
108767-108775
0.000
1
6mer
124772-124788
0.000
2
6mer
248508-248528
0.000
1
6mer
58100-58126
0.000
2
6mer
124776-124794
0.000
4
6mer
108766-108777
0.000
2
6mer
62971-62984
0.000
2
6mer
108767-108779
0.000
2
6mer
217553-217572
0.000
3
8mer+mismatch
260104-260129
0.000
Not Conserved
6mer
124772-124792
0.000
2
6mer
124772-124790
0.000
1
6mer
108766-108781
0.000
1
6mer
257542-257561
0.000
1
6mer
254871-254889
0.000
1
Funded by: