Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-582-3p

ENST00000621103
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
AC034220.3
hsa-miR-582-3p
0.510

Gene Details
Chromosome: 5
Transcript: ENST00000621103
Biotype: antisense
Gene id: ENSG00000233006
Gene Name: AC034220.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1225-1234
0.010
4
6mer
898-921
0.002
2
Funded by: