Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-582-3p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
RP11-264B17.3
hsa-miR-582-3p
0.834

Gene Details
Chromosome: 16
Transcript: ENST00000569969
Biotype: retained_intron
Gene id: ENSG00000261067
Gene Name: RP11-264B17.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
747-764
0.018
11
7mer
566-587
0.016
10
7mer
3776-3796
0.003
2
6mer
3793-3818
0.000
1
LINC00640
hsa-miR-582-3p
0.834

Gene Details
Chromosome: 14
Transcript: ENST00000556479
Biotype: lincRNA
Gene id: ENSG00000258479
Gene Name: LINC00640
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
81-100
0.037
5
XLOC_004799
hsa-miR-582-3p
0.834

Gene Details
Chromosome: chr5
Transcript: TCONS_00010313
Biotype: transcript isomorph
Gene id: XLOC_004799
Gene Name: XLOC_004799
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Kidney Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
228-248
0.021
2
8mer
1703-1714
0.013
1
6mer
637-652
0.002
1
XLOC_011548
hsa-miR-582-3p
0.833

Gene Details
Chromosome: chr15
Transcript: TCONS_00023756
Biotype: transcript isomorph
Gene id: XLOC_011548
Gene Name: XLOC_011548
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
K562 Blood Cancer/Malignant
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Lung Normal/Primary
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Placenta Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
101-113
0.037
1
DSCAM-AS1
hsa-miR-582-3p
0.833

Gene Details
Chromosome: 21
Transcript: ENST00000455354
Biotype: antisense
Gene id: ENSG00000235123
Gene Name: DSCAM-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
433-447
0.028
2
6mer
979-996
0.009
3
RP11-927P21.1
hsa-miR-582-3p
0.832

Gene Details
Chromosome: 17
Transcript: ENST00000584959
Biotype: antisense
Gene id: ENSG00000265218
Gene Name: RP11-927P21.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
A549 Lung Cancer/Malignant
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
18-32
0.033
3
6mer
423-441
0.004
1
AC025918.2
hsa-miR-582-3p
0.830

Gene Details
Chromosome: 15
Transcript: ENST00000452467
Biotype: antisense
Gene id: ENSG00000225798
Gene Name: AC025918.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
97-119
0.037
2
XLOC_002770
hsa-miR-582-3p
0.830

Gene Details
Chromosome: chr3
Transcript: TCONS_00006165
Biotype: transcript isomorph
Gene id: XLOC_002770
Gene Name: XLOC_002770
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
402-422
0.037
3
RP11-29G8.3
hsa-miR-582-3p
0.828

Gene Details
Chromosome: 13
Transcript: ENST00000563635
Biotype: processed_transcript
Gene id: ENSG00000261553
Gene Name: RP11-29G8.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
hMSC-BM Bone Marrow Stem/Progenitor
HeLa Cervix Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
90-103
0.036
9
RP11-128I7.1
hsa-miR-582-3p
0.828

Gene Details
Chromosome: 9
Transcript: ENST00000422909
Biotype: lincRNA
Gene id: ENSG00000232590
Gene Name: RP11-128I7.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
352-373
0.036
1
RP11-156P1.3
hsa-miR-582-3p
0.827

Gene Details
Chromosome: 17
Transcript: ENST00000571143
Biotype: lincRNA
Gene id: ENSG00000262879
Gene Name: RP11-156P1.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
287-301
0.030
3
6mer
114-133
0.006
3
CTC-1337H24.4
hsa-miR-582-3p
0.826

Gene Details
Chromosome: 11
Transcript: ENST00000616071
Biotype: lincRNA
Gene id: ENSG00000275484
Gene Name: CTC-1337H24.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
61-83
0.036
8
RP11-1070N10.4
hsa-miR-582-3p
0.826

Gene Details
Chromosome: 14
Transcript: ENST00000556346
Biotype: lincRNA
Gene id: ENSG00000258390
Gene Name: RP11-1070N10.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
10-28
0.036
2
RP11-24M17.4
hsa-miR-582-3p
0.826

Gene Details
Chromosome: 15
Transcript: ENST00000623240
Biotype: TEC
Gene id: ENSG00000260288
Gene Name: RP11-24M17.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
814-824
0.036
2
RP11-156P1.3
hsa-miR-582-3p
0.825

Gene Details
Chromosome: 17
Transcript: ENST00000575930
Biotype: lincRNA
Gene id: ENSG00000262879
Gene Name: RP11-156P1.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
39-53
0.031
3
6mer
148-160
0.005
3
DPH6-AS1
hsa-miR-582-3p
0.824

Gene Details
Chromosome: 15
Transcript: ENST00000501169
Biotype: lincRNA
Gene id: ENSG00000248079
Gene Name: DPH6-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1055-1064
0.020
5
7mer
580-597
0.016
8
RP11-322E11.2
hsa-miR-582-3p
0.823

Gene Details
Chromosome: 18
Transcript: ENST00000612496
Biotype: lincRNA
Gene id: ENSG00000275512
Gene Name: RP11-322E11.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
697-707
0.019
1
6mer
1845-1853
0.007
2
6mer
1470-1494
0.006
2
6mer
1807-1825
0.003
1
RP11-111K18.2
hsa-miR-582-3p
0.822

Gene Details
Chromosome: 7
Transcript: ENST00000569883
Biotype: lincRNA
Gene id: ENSG00000261019
Gene Name: RP11-111K18.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
868-883
0.027
2
6mer
1091-1113
0.008
2
RP11-1006G14.4
hsa-miR-582-3p
0.822

Gene Details
Chromosome: 15
Transcript: ENST00000566291
Biotype: sense_overlapping
Gene id: ENSG00000260534
Gene Name: RP11-1006G14.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
516-532
0.036
2
XLOC_007654
hsa-miR-582-3p
0.822

Gene Details
Chromosome: chr9
Transcript: TCONS_00016279
Biotype: transcript isomorph
Gene id: XLOC_007654
Gene Name: XLOC_007654
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1376-1384
0.026
2
6mer
1661-1676
0.006
4
6mer
417-434
0.004
2
Funded by: