Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-582-3p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
CTD-2313J23.1
hsa-miR-582-3p
0.982

Gene Details
Chromosome: 16
Transcript: ENST00000566929
Biotype: lincRNA
Gene id: ENSG00000260072
Gene Name: CTD-2313J23.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
698-714
0.050
3
8mer
535-557
0.022
2
6mer
3678-3699
0.003
4
6mer
4733-4753
0.001
1
RP11-624L4.1
hsa-miR-582-3p
0.982

Gene Details
Chromosome: 15
Transcript: ENST00000560484
Biotype: lincRNA
Gene id: ENSG00000259345
Gene Name: RP11-624L4.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
4-21
0.076
2
SLC14A2-AS1
hsa-miR-582-3p
0.978

Gene Details
Chromosome: 18
Transcript: ENST00000592286
Biotype: antisense
Gene id: ENSG00000267097
Gene Name: SLC14A2-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
489-499
0.073
8
MIR6818
hsa-miR-582-3p
0.978

Gene Details
Chromosome: 22
Transcript: ENST00000624945
Biotype: antisense
Gene id: ENSG00000279159
Gene Name: MIR6818
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
990-1010
0.016
6
9mer
23806-23816
0.010
1
8mer
48265-48273
0.008
3
7mer
12116-12136
0.006
3
7mer
31706-31718
0.004
3
6mer
46819-46842
0.004
11
7mer
37584-37605
0.004
8
7mer
26737-26744
0.003
2
7mer
45601-45622
0.003
2
6mer
30567-30575
0.003
4
6mer
26030-26053
0.002
1
6mer
43410-43427
0.002
5
6mer
10717-10729
0.002
2
6mer
24054-24071
0.002
1
6mer
7454-7469
0.001
1
6mer
25729-25753
0.001
2
6mer
47947-47964
0.001
1
6mer
23988-23998
0.001
2
6mer
47146-47162
0.001
1
6mer
24674-24693
0.001
1
MIR4534
hsa-miR-582-3p
0.977

Gene Details
Chromosome: 22
Transcript: ENST00000623111
Biotype: sense_overlapping
Gene id: ENSG00000279010
Gene Name: MIR4534
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
53987-54003
0.020
2
7mer
45708-45730
0.006
2
7mer
23503-23526
0.005
1
7mer
8608-8618
0.004
3
7mer
4909-4929
0.004
2
8mer
43234-43257
0.004
2
6mer
37611-37630
0.003
9
6mer
32592-32607
0.002
4
6mer
43140-43157
0.002
2
6mer
9520-9530
0.002
2
6mer
30085-30107
0.002
2
6mer
9191-9209
0.002
2
6mer
52519-52542
0.001
2
6mer
50919-50933
0.001
2
6mer
33045-33067
0.001
2
6mer
5834-5857
0.001
2
6mer
27055-27078
0.001
4
6mer
10708-10724
0.001
1
6mer
51155-51179
0.001
2
6mer
48073-48098
0.001
1
6mer
43453-43460
0.001
2
6mer
9755-9775
0.001
2
6mer
39476-39483
0.001
2
6mer
8697-8720
0.001
6
6mer
41692-41710
0.001
1
6mer
18472-18492
0.001
2
RP11-143P4.2
hsa-miR-582-3p
0.976

Gene Details
Chromosome: 3
Transcript: ENST00000414895
Biotype: lincRNA
Gene id: ENSG00000232130
Gene Name: RP11-143P4.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
49-67
0.072
4
AC006552.1
hsa-miR-582-3p
0.974

Gene Details
Chromosome: 4
Transcript: ENST00000508484
Biotype: lincRNA
Gene id: ENSG00000250456
Gene Name: AC006552.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
51-59
0.052
1
8mer
718-738
0.019
1
XLOC_003949
hsa-miR-582-3p
0.974

Gene Details
Chromosome: chr4
Transcript: TCONS_00007422
Biotype: transcript isomorph
Gene id: XLOC_003949
Gene Name: XLOC_003949
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
49-57
0.051
1
8mer
716-736
0.019
1
RP11-75L1.1
hsa-miR-582-3p
0.971

Gene Details
Chromosome: 12
Transcript: ENST00000541404
Biotype: lincRNA
Gene id: ENSG00000256582
Gene Name: RP11-75L1.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
84-95
0.068
1
XLOC_005951
hsa-miR-582-3p
0.971

Gene Details
Chromosome: chr6
Transcript: TCONS_00011629
Biotype: transcript isomorph
Gene id: XLOC_005951
Gene Name: XLOC_005951
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
Fibroblasts Lung Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
360-379
0.036
1
9mer
301-320
0.033
1
PWAR6
hsa-miR-582-3p
0.968

Gene Details
Chromosome: 15
Transcript: ENST00000552334
Biotype: lincRNA
Gene id: ENSG00000257151
Gene Name: PWAR6
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
HUVEC Blood Vessel Normal/Primary
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HREpiC Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
4488-4504
0.052
1
7mer
3558-3568
0.009
2
7mer
1867-1882
0.006
2
CASC16
hsa-miR-582-3p
0.967

Gene Details
Chromosome: 16
Transcript: ENST00000563844
Biotype: lincRNA
Gene id: ENSG00000249231
Gene Name: CASC16
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
571-590
0.066
4
XLOC_004566
hsa-miR-582-3p
0.966

Gene Details
Chromosome: chr5
Transcript: TCONS_00010102
Biotype: transcript isomorph
Gene id: XLOC_004566
Gene Name: XLOC_004566
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Ovary Normal/Primary
- Thyroid Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
143-158
0.065
2
GMDS-AS1
hsa-miR-582-3p
0.965

Gene Details
Chromosome: 6
Transcript: ENST00000530833
Biotype: lincRNA
Gene id: ENSG00000250903
Gene Name: GMDS-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HREpiC Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
Fibroblasts Lung Normal/Primary
- Lung Normal/Primary
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
394-418
0.065
1
RP11-474G23.3
hsa-miR-582-3p
0.964

Gene Details
Chromosome: 2
Transcript: ENST00000608069
Biotype: antisense
Gene id: ENSG00000273064
Gene Name: RP11-474G23.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
683-693
0.065
3
AC034187.2
hsa-miR-582-3p
0.964

Gene Details
Chromosome: 3
Transcript: ENST00000437047
Biotype: lincRNA
Gene id: ENSG00000224884
Gene Name: AC034187.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
138-157
0.064
2
AL022344.7
hsa-miR-582-3p
0.957

Gene Details
Chromosome: 10
Transcript: ENST00000568976
Biotype: lincRNA
Gene id: ENSG00000259869
Gene Name: AL022344.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
835-858
0.047
1
6mer
510-525
0.014
1
RP11-597D13.9
hsa-miR-582-3p
0.955

Gene Details
Chromosome: 4
Transcript: ENST00000509463
Biotype: antisense
Gene id: ENSG00000248429
Gene Name: RP11-597D13.9
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
98-114
0.061
10
EEF1E1-BLOC1S5
hsa-miR-582-3p
0.955

Gene Details
Chromosome: 6
Transcript: NR_037618.1
Biotype: sense
Gene id: NR_037618.1 (gene)
Gene Name: EEF1E1-BLOC1S5
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2491-2506
0.046
9
6mer
2824-2847
0.008
9
7mer
1058-1068
0.007
2
XLOC_010470
hsa-miR-582-3p
0.955

Gene Details
Chromosome: chr13
Transcript: TCONS_00021871
Biotype: transcript isomorph
Gene id: XLOC_010470
Gene Name: XLOC_010470
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Kidney Normal/Primary
- Placenta Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1703-1724
0.050
5
6mer
1085-1098
0.006
6
6mer
1442-1467
0.005
2
Funded by: