Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-582-3p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
AC079466.1
hsa-miR-582-3p
0.954

Gene Details
Chromosome: 19
Transcript: ENST00000587961
Biotype: lincRNA
Gene id: ENSG00000266976
Gene Name: AC079466.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
3883-3892
0.035
2
7mer
2807-2820
0.022
2
6mer
2917-2934
0.004
2
BLOC1S5-TXNDC5
hsa-miR-582-3p
0.953

Gene Details
Chromosome: 6
Transcript: NR_037616.1
Biotype: sense
Gene id: NR_037616.1 (gene)
Gene Name: BLOC1S5-TXNDC5
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
3159-3174
0.057
9
6mer
1039-1057
0.003
1
RP11-163F15.1
hsa-miR-582-3p
0.952

Gene Details
Chromosome: 10
Transcript: ENST00000366253
Biotype: lincRNA
Gene id: ENSG00000203434
Gene Name: RP11-163F15.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
41-57
0.060
2
ERVK3-1
hsa-miR-582-3p
0.951

Gene Details
Chromosome: 19
Transcript: ENST00000590505
Biotype: retained_intron
Gene id: ENSG00000142396
Gene Name: ERVK3-1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
232-253
0.055
1
6mer
1097-1123
0.004
1
RP11-378J18.9
hsa-miR-582-3p
0.949

Gene Details
Chromosome: 1
Transcript: ENST00000617276
Biotype: lincRNA
Gene id: ENSG00000276997
Gene Name: RP11-378J18.9
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
31-49
0.058
2
XLOC_013703
hsa-miR-582-3p
0.948

Gene Details
Chromosome: chr20
Transcript: TCONS_00028028
Biotype: transcript isomorph
Gene id: XLOC_013703
Gene Name: XLOC_013703
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Liver Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1406-1422
0.027
1
6mer
192-216
0.014
1
6mer
1043-1057
0.009
1
6mer
1268-1282
0.009
1
XLOC_000615
hsa-miR-582-3p
0.947

Gene Details
Chromosome: chr1
Transcript: TCONS_00000418
Biotype: transcript isomorph
Gene id: XLOC_000615
Gene Name: XLOC_000615
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
679-697
0.041
2
7mer
491-512
0.008
2
6mer
772-786
0.008
4
AC005076.5
hsa-miR-582-3p
0.946

Gene Details
Chromosome: 7
Transcript: ENST00000433446
Biotype: antisense
Gene id: ENSG00000224046
Gene Name: AC005076.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
73-80
0.053
5
6mer
389-405
0.004
2
CTD-2145A24.5
hsa-miR-582-3p
0.946

Gene Details
Chromosome: 17
Transcript: ENST00000584957
Biotype: lincRNA
Gene id: ENSG00000265478
Gene Name: CTD-2145A24.5
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
238-262
0.055
2
6mer
455-478
0.002
Not Conserved
NR2F2-AS1
hsa-miR-582-3p
0.945

Gene Details
Chromosome: 15
Transcript: ENST00000616032
Biotype: antisense
Gene id: ENSG00000247809
Gene Name: NR2F2-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
88-112
0.057
5
NR2F2-AS1
hsa-miR-582-3p
0.944

Gene Details
Chromosome: 15
Transcript: ENST00000618776
Biotype: antisense
Gene id: ENSG00000247809
Gene Name: NR2F2-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
403-427
0.057
5
LINC01347
hsa-miR-582-3p
0.943

Gene Details
Chromosome: 1
Transcript: ENST00000438255
Biotype: lincRNA
Gene id: ENSG00000214837
Gene Name: LINC01347
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
31-49
0.057
2
RP11-380J14.1
hsa-miR-582-3p
0.943

Gene Details
Chromosome: 1
Transcript: ENST00000412427
Biotype: lincRNA
Gene id: ENSG00000204362
Gene Name: RP11-380J14.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
Fibroblasts Foreskin Normal/Primary
- Kidney Normal/Primary
- Placenta Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
4550-4557
0.057
1
PCBP1-AS1
hsa-miR-582-3p
0.942

Gene Details
Chromosome: 2
Transcript: ENST00000456161
Biotype: antisense
Gene id: ENSG00000179818
Gene Name: PCBP1-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
9-27
0.056
3
TTTY4C
hsa-miR-582-3p
0.941

Gene Details
Chromosome: Y
Transcript: ENST00000456123
Biotype: lincRNA
Gene id: ENSG00000228296
Gene Name: TTTY4C
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
2-13
0.056
1
TTTY4B
hsa-miR-582-3p
0.941

Gene Details
Chromosome: Y
Transcript: ENST00000420149
Biotype: lincRNA
Gene id: ENSG00000235412
Gene Name: TTTY4B
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1334-1345
0.056
1
TTTY4
hsa-miR-582-3p
0.941

Gene Details
Chromosome: Y
Transcript: ENST00000436568
Biotype: lincRNA
Gene id: ENSG00000226906
Gene Name: TTTY4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1334-1345
0.056
1
RP11-736I10.1
hsa-miR-582-3p
0.940

Gene Details
Chromosome: 11
Transcript: ENST00000534388
Biotype: lincRNA
Gene id: ENSG00000255393
Gene Name: RP11-736I10.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
330-349
0.042
3
7mer
393-406
0.014
2
FAM66C
hsa-miR-582-3p
0.939

Gene Details
Chromosome: 12
Transcript: ENST00000420514
Biotype: antisense
Gene id: ENSG00000226711
Gene Name: FAM66C
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
346-353
0.039
1
6mer
278-297
0.017
1
AC004543.2
hsa-miR-582-3p
0.938

Gene Details
Chromosome: 7
Transcript: ENST00000418764
Biotype: lincRNA
Gene id: ENSG00000237921
Gene Name: AC004543.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
39-63
0.038
1
7mer
270-294
0.017
2
Funded by: