Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-582-3p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
XLOC_005501
hsa-miR-582-3p
0.938

Gene Details
Chromosome: chr6
Transcript: TCONS_00012617
Biotype: transcript isomorph
Gene id: XLOC_005501
Gene Name: XLOC_005501
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Prostate Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
74-93
0.031
2
7mer
1674-1681
0.015
1
6mer
869-888
0.009
2
AC007392.4
hsa-miR-582-3p
0.931

Gene Details
Chromosome: 2
Transcript: ENST00000433432
Biotype: lincRNA
Gene id: ENSG00000237179
Gene Name: AC007392.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Colon Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
551-566
0.053
13
RP11-78O9.1
hsa-miR-582-3p
0.931

Gene Details
Chromosome: 1
Transcript: ENST00000439455
Biotype: antisense
Gene id: ENSG00000233482
Gene Name: RP11-78O9.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
184-203
0.053
1
RP11-218F4.1
hsa-miR-582-3p
0.929

Gene Details
Chromosome: 17
Transcript: ENST00000567574
Biotype: lincRNA
Gene id: ENSG00000260019
Gene Name: RP11-218F4.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
764-784
0.048
2
6mer
1112-1132
0.005
2
RP11-91N2.3
hsa-miR-582-3p
0.927

Gene Details
Chromosome: 9
Transcript: ENST00000445631
Biotype: lincRNA
Gene id: ENSG00000231052
Gene Name: RP11-91N2.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
60-65
0.052
2
AC005076.5
hsa-miR-582-3p
0.924

Gene Details
Chromosome: 7
Transcript: ENST00000446309
Biotype: antisense
Gene id: ENSG00000224046
Gene Name: AC005076.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
56-63
0.052
5
XLOC_008895
hsa-miR-582-3p
0.923

Gene Details
Chromosome: chr10
Transcript: TCONS_00018569
Biotype: transcript isomorph
Gene id: XLOC_008895
Gene Name: XLOC_008895
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Lung Normal/Primary
- Placenta Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1542-1551
0.051
6
RP11-162J8.2
hsa-miR-582-3p
0.923

Gene Details
Chromosome: 6
Transcript: ENST00000413845
Biotype: antisense
Gene id: ENSG00000227660
Gene Name: RP11-162J8.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
589-603
0.046
6
7mer
463-488
0.004
1
6mer
452-467
0.002
1
AC007251.2
hsa-miR-582-3p
0.920

Gene Details
Chromosome: 2
Transcript: ENST00000611915
Biotype: lincRNA
Gene id: ENSG00000277527
Gene Name: AC007251.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
603-620
0.038
3
7mer
200-217
0.008
2
6mer
241-257
0.005
2
RP11-159H10.3
hsa-miR-582-3p
0.918

Gene Details
Chromosome: 8
Transcript: ENST00000528800
Biotype: antisense
Gene id: ENSG00000246528
Gene Name: RP11-159H10.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
931-955
0.015
1
7mer
820-844
0.015
2
7mer
713-737
0.013
1
6mer
110-117
0.004
1
6mer
568-580
0.003
2
RP11-356I2.4
hsa-miR-582-3p
0.917

Gene Details
Chromosome: 6
Transcript: ENST00000431144
Biotype: antisense
Gene id: ENSG00000237499
Gene Name: RP11-356I2.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
- Breast Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
334-359
0.050
1
LOC100190986
hsa-miR-582-3p
0.916

Gene Details
Chromosome: 16
Transcript: NR_024456.1
Biotype: sense
Gene id: NR_024456.1 (gene)
Gene Name: LOC100190986
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
876-884
0.041
1
6mer
1070-1085
0.009
1
GJA9-MYCBP
hsa-miR-582-3p
0.916

Gene Details
Chromosome: 1
Transcript: NR_037633.1
Biotype: sense
Gene id: NR_037633.1 (gene)
Gene Name: GJA9-MYCBP
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
3882-3890
0.023
3
8mer
111-117
0.014
2
7mer
2930-2938
0.005
3
6mer
4641-4662
0.003
2
6mer
1636-1653
0.002
4
6mer
1495-1519
0.001
6
6mer
3643-3661
0.001
3
LOC101926889
hsa-miR-582-3p
0.915

Gene Details
Chromosome: 20
Transcript: NR_109994.1
Biotype: antisense
Gene id: NR_109994.1 (gene)
Gene Name: LOC101926889
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
212-229
0.050
1
RP11-205M3.3
hsa-miR-582-3p
0.914

Gene Details
Chromosome: 4
Transcript: ENST00000508313
Biotype: lincRNA
Gene id: ENSG00000248319
Gene Name: RP11-205M3.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
666-675
0.045
3
7mer
944-960
0.003
2
6mer
2158-2173
0.001
1
FLJ22763
hsa-miR-582-3p
0.912

Gene Details
Chromosome: 3
Transcript: ENST00000616779
Biotype: lincRNA
Gene id: ENSG00000241224
Gene Name: FLJ22763
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
19-45
0.044
6
6mer
303-310
0.005
1
RP11-570L15.1
hsa-miR-582-3p
0.910

Gene Details
Chromosome: 2
Transcript: ENST00000553076
Biotype: antisense
Gene id: ENSG00000258268
Gene Name: RP11-570L15.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
25-45
0.049
1
PCBP1-AS1
hsa-miR-582-3p
0.909

Gene Details
Chromosome: 2
Transcript: ENST00000617142
Biotype: antisense
Gene id: ENSG00000179818
Gene Name: PCBP1-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
362-380
0.048
3
XLOC_013702
hsa-miR-582-3p
0.907

Gene Details
Chromosome: chr20
Transcript: TCONS_00028351
Biotype: transcript isomorph
Gene id: XLOC_013702
Gene Name: XLOC_013702
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
195-219
0.025
2
8mer
69-82
0.023
1
RP1-30M3.6
hsa-miR-582-3p
0.906

Gene Details
Chromosome: 6
Transcript: ENST00000606921
Biotype: antisense
Gene id: ENSG00000272402
Gene Name: RP1-30M3.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
221-233
0.048
2
Funded by: