Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-582-3p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
RP11-363G2.4
hsa-miR-582-3p
0.902

Gene Details
Chromosome: 13
Transcript: ENST00000445646
Biotype: lincRNA
Gene id: ENSG00000229556
Gene Name: RP11-363G2.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
49-74
0.047
1
SCGB1B2P
hsa-miR-582-3p
0.899

Gene Details
Chromosome: 19
Transcript: ENST00000595013
Biotype: lincRNA
Gene id: ENSG00000268751
Gene Name: SCGB1B2P
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
409-423
0.046
2
SCGB1B2P
hsa-miR-582-3p
0.898

Gene Details
Chromosome: 19
Transcript: ENST00000597830
Biotype: lincRNA
Gene id: ENSG00000268751
Gene Name: SCGB1B2P
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
355-369
0.046
2
XLOC_009544
hsa-miR-582-3p
0.898

Gene Details
Chromosome: chr11
Transcript: TCONS_00019750
Biotype: transcript isomorph
Gene id: XLOC_009544
Gene Name: XLOC_009544
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
- Liver Normal/Primary
Fibroblasts Lung Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
4337-4358
0.025
2
7mer
152-170
0.009
2
6mer
3635-3653
0.005
2
6mer
1140-1151
0.002
1
6mer
3561-3574
0.002
2
6mer
1431-1449
0.002
2
LOC100505912
hsa-miR-582-3p
0.898

Gene Details
Chromosome: 4
Transcript: NR_037877.1
Biotype: lincRNA
Gene id: NR_037877.1 (gene)
Gene Name: LOC100505912
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
212-234
0.030
1
8mer+wobble
664-685
0.017
1
RP11-380O24.1
hsa-miR-582-3p
0.897

Gene Details
Chromosome: 3
Transcript: ENST00000491930
Biotype: antisense
Gene id: ENSG00000254485
Gene Name: RP11-380O24.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
77-94
0.040
6
6mer
43-56
0.006
3
TSIX
hsa-miR-582-3p
0.895

Gene Details
Chromosome: X
Transcript: ENST00000604411
Biotype: lincRNA
Gene id: ENSG00000270641
Gene Name: TSIX
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
24856-24869
0.012
1
8mer
7816-7825
0.011
1
8mer
27377-27383
0.005
Not Conserved
6mer
26863-26885
0.002
3
6mer
24123-24139
0.002
1
6mer
21797-21819
0.002
2
6mer
28481-28499
0.002
3
6mer
31830-31843
0.002
2
6mer
7566-7582
0.002
1
6mer
5020-5037
0.002
2
6mer
17237-17246
0.001
2
6mer
20084-20100
0.001
2
6mer
24241-24256
0.001
2
6mer
27380-27390
0.001
2
XLOC_001401
hsa-miR-582-3p
0.894

Gene Details
Chromosome: chr2
Transcript: TCONS_00003609
Biotype: transcript isomorph
Gene id: XLOC_001401
Gene Name: XLOC_001401
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
2374-2385
0.016
1
6mer
2126-2150
0.011
1
6mer
1766-1782
0.010
1
6mer
1606-1627
0.008
1
XLOC_013577
hsa-miR-582-3p
0.894

Gene Details
Chromosome: chr20
Transcript: TCONS_00028233
Biotype: transcript isomorph
Gene id: XLOC_013577
Gene Name: XLOC_013577
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
509-535
0.046
5
RP11-757G1.6
hsa-miR-582-3p
0.894

Gene Details
Chromosome: 11
Transcript: ENST00000512200
Biotype: lincRNA
Gene id: ENSG00000250508
Gene Name: RP11-757G1.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
HUVEC Blood Vessel Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1845-1856
0.026
1
6mer
2360-2371
0.011
1
6mer
936-941
0.009
1
XLOC_013305
hsa-miR-582-3p
0.894

Gene Details
Chromosome: chr19
Transcript: TCONS_00026763
Biotype: transcript isomorph
Gene id: XLOC_013305
Gene Name: XLOC_013305
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
408-422
0.046
2
NPHP3-AS1
hsa-miR-582-3p
0.893

Gene Details
Chromosome: 3
Transcript: ENST00000489343
Biotype: antisense
Gene id: ENSG00000248724
Gene Name: NPHP3-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1227-1244
0.045
2
XLOC_002926
hsa-miR-582-3p
0.893

Gene Details
Chromosome: chr3
Transcript: TCONS_00006316
Biotype: transcript isomorph
Gene id: XLOC_002926
Gene Name: XLOC_002926
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
509-530
0.036
6
6mer
880-896
0.009
5
RP11-677M14.7
hsa-miR-582-3p
0.892

Gene Details
Chromosome: 11
Transcript: ENST00000529392
Biotype: antisense
Gene id: ENSG00000245498
Gene Name: RP11-677M14.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HepG2 Liver Cancer/Malignant
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
87-108
0.025
3
7mer
104-129
0.017
4
6mer
1082-1099
0.002
2
6mer
1128-1145
0.001
2
CTA-796E4.5
hsa-miR-582-3p
0.892

Gene Details
Chromosome: 22
Transcript: ENST00000624243
Biotype: lincRNA
Gene id: ENSG00000280065
Gene Name: CTA-796E4.5
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
18949-18964
0.011
2
8mer
5110-5126
0.011
4
7mer
23598-23612
0.005
2
7mer
13368-13373
0.004
1
6mer
31035-31057
0.004
2
6mer
1127-1143
0.003
2
6mer
7600-7614
0.002
2
6mer
20836-20840
0.002
3
6mer
13092-13111
0.001
2
6mer
6112-6131
0.001
2
6mer
11009-11028
0.001
2
RP11-568N6.1
hsa-miR-582-3p
0.891

Gene Details
Chromosome: 2
Transcript: ENST00000561559
Biotype: lincRNA
Gene id: ENSG00000260101
Gene Name: RP11-568N6.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
218-224
0.043
2
6mer
1108-1125
0.002
2
RP11-744K17.1
hsa-miR-582-3p
0.889

Gene Details
Chromosome: 17
Transcript: ENST00000562182
Biotype: lincRNA
Gene id: ENSG00000261020
Gene Name: RP11-744K17.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
4552-4563
0.036
2
7mer
1849-1854
0.008
2
RP11-597D13.9
hsa-miR-582-3p
0.888

Gene Details
Chromosome: 4
Transcript: ENST00000503611
Biotype: antisense
Gene id: ENSG00000248429
Gene Name: RP11-597D13.9
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
574-590
0.038
10
6mer
2663-2688
0.007
3
RP11-253M7.6
hsa-miR-582-3p
0.887

Gene Details
Chromosome: 15
Transcript: ENST00000560870
Biotype: sense_intronic
Gene id: ENSG00000259645
Gene Name: RP11-253M7.6
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
108-121
0.044
2
LINC00554
hsa-miR-582-3p
0.885

Gene Details
Chromosome: 13
Transcript: ENST00000564841
Biotype: antisense
Gene id: ENSG00000260738
Gene Name: LINC00554
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1357-1379
0.044
10
Funded by: