Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-582-3p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
XLOC_011772
hsa-miR-582-3p
0.884

Gene Details
Chromosome: chr16
Transcript: TCONS_00024294
Biotype: transcript isomorph
Gene id: XLOC_011772
Gene Name: XLOC_011772
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
- Kidney Normal/Primary
- Lung Normal/Primary
- Ovary Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1120-1143
0.034
6
6mer
542-556
0.004
1
7mer
1862-1871
0.003
2
6mer
3455-3481
0.003
2
RP11-96C23.9
hsa-miR-582-3p
0.884

Gene Details
Chromosome: 10
Transcript: ENST00000454709
Biotype: sense_intronic
Gene id: ENSG00000237280
Gene Name: RP11-96C23.9
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
125-152
0.044
4
RBFADN
hsa-miR-582-3p
0.884

Gene Details
Chromosome: 18
Transcript: ENST00000568911
Biotype: lincRNA
Gene id: ENSG00000261126
Gene Name: RBFADN
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
4574-4592
0.040
2
6mer
1749-1765
0.002
2
7mer
1789-1812
0.001
1
FLVCR1-AS1
hsa-miR-582-3p
0.883

Gene Details
Chromosome: 1
Transcript: ENST00000356684
Biotype: lincRNA
Gene id: ENSG00000198468
Gene Name: FLVCR1-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
Fibroblasts Lung Normal/Primary
A549 Lung Cancer/Malignant
- Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1868-1894
0.041
3
6mer
1241-1259
0.003
2
AC007620.3
hsa-miR-582-3p
0.883

Gene Details
Chromosome: 3
Transcript: ENST00000600539
Biotype: antisense
Gene id: ENSG00000242539
Gene Name: AC007620.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
193-210
0.044
2
RP11-388P9.2
hsa-miR-582-3p
0.883

Gene Details
Chromosome: 10
Transcript: ENST00000414383
Biotype: antisense
Gene id: ENSG00000232682
Gene Name: RP11-388P9.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
151-175
0.025
5
6mer
247-256
0.006
7
6mer
775-787
0.004
9
6mer
595-613
0.004
8
6mer
563-580
0.004
5
RBFADN
hsa-miR-582-3p
0.883

Gene Details
Chromosome: 18
Transcript: ENST00000564686
Biotype: lincRNA
Gene id: ENSG00000261126
Gene Name: RBFADN
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
152-170
0.044
2
FAM66C
hsa-miR-582-3p
0.882

Gene Details
Chromosome: 12
Transcript: ENST00000438689
Biotype: antisense
Gene id: ENSG00000226711
Gene Name: FAM66C
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
296-318
0.015
1
6mer
91-110
0.015
1
6mer
136-161
0.014
1
XX-C2158C6.3
hsa-miR-582-3p
0.881

Gene Details
Chromosome: 6
Transcript: ENST00000415530
Biotype: lincRNA
Gene id: ENSG00000225532
Gene Name: XX-C2158C6.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
300-319
0.043
1
FLJ22763
hsa-miR-582-3p
0.881

Gene Details
Chromosome: 3
Transcript: ENST00000619765
Biotype: lincRNA
Gene id: ENSG00000241224
Gene Name: FLJ22763
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
19-45
0.043
6
GJA9-MYCBP
hsa-miR-582-3p
0.879

Gene Details
Chromosome: 1
Transcript: NR_037634.1
Biotype: sense
Gene id: NR_037634.1 (gene)
Gene Name: GJA9-MYCBP
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
3014-3022
0.023
3
8mer
111-117
0.014
2
6mer
3773-3794
0.003
2
6mer
1636-1653
0.002
4
6mer
1495-1519
0.002
6
RP4-568C11.4
hsa-miR-582-3p
0.877

Gene Details
Chromosome: 20
Transcript: ENST00000620459
Biotype: lincRNA
Gene id: ENSG00000274173
Gene Name: RP4-568C11.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
47-57
0.032
1
6mer
802-824
0.011
1
RP5-1125A11.4
hsa-miR-582-3p
0.876

Gene Details
Chromosome: 20
Transcript: ENST00000451556
Biotype: lincRNA
Gene id: ENSG00000228386
Gene Name: RP5-1125A11.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
571-591
0.020
2
7mer
41-55
0.017
4
6mer
537-551
0.006
3
RP11-258C19.7
hsa-miR-582-3p
0.876

Gene Details
Chromosome: X
Transcript: ENST00000603385
Biotype: lincRNA
Gene id: ENSG00000270189
Gene Name: RP11-258C19.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
358-384
0.043
2
RP11-803B1.8
hsa-miR-582-3p
0.876

Gene Details
Chromosome: 3
Transcript: ENST00000608707
Biotype: lincRNA
Gene id: ENSG00000272690
Gene Name: RP11-803B1.8
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HREpiC Kidney Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
65-83
0.043
6
DSCAM-AS1
hsa-miR-582-3p
0.876

Gene Details
Chromosome: 21
Transcript: NR_038899.1
Biotype: antisense
Gene id: NR_038899.1 (gene)
Gene Name: DSCAM-AS1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
335-349
0.034
2
6mer
881-898
0.009
3
LINC00847
hsa-miR-582-3p
0.876

Gene Details
Chromosome: 5
Transcript: ENST00000509921
Biotype: lincRNA
Gene id: ENSG00000245060
Gene Name: LINC00847
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
683-702
0.043
2
RP11-76K13.3
hsa-miR-582-3p
0.875

Gene Details
Chromosome: 18
Transcript: ENST00000581502
Biotype: antisense
Gene id: ENSG00000264475
Gene Name: RP11-76K13.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
516-533
0.043
7
XLOC_012370
hsa-miR-582-3p
0.875

Gene Details
Chromosome: chr17
Transcript: TCONS_00025543
Biotype: transcript isomorph
Gene id: XLOC_012370
Gene Name: XLOC_012370
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
- Heart Normal/Primary
- Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1104-1120
0.028
1
6mer
180-201
0.013
1
6mer
1504-1525
0.002
Not Conserved
DSCAM-AS1
hsa-miR-582-3p
0.875

Gene Details
Chromosome: 21
Transcript: ENST00000422749
Biotype: antisense
Gene id: ENSG00000235123
Gene Name: DSCAM-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
336-350
0.034
2
6mer
882-899
0.009
3
Funded by: