Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-582-3p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
XLOC_000910
hsa-miR-582-3p
0.875

Gene Details
Chromosome: chr1
Transcript: TCONS_00001575
Biotype: transcript isomorph
Gene id: XLOC_000910
Gene Name: XLOC_000910
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Heart Normal/Primary
- Lung Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1111-1137
0.035
2
6mer
20-43
0.007
3
XLOC_009222
hsa-miR-582-3p
0.874

Gene Details
Chromosome: chr11
Transcript: TCONS_00019399
Biotype: transcript isomorph
Gene id: XLOC_009222
Gene Name: XLOC_009222
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Heart Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
5243-5256
0.028
1
6mer
1550-1558
0.008
1
6mer
4650-4660
0.006
1
LINC00847
hsa-miR-582-3p
0.873

Gene Details
Chromosome: 5
Transcript: ENST00000508309
Biotype: lincRNA
Gene id: ENSG00000245060
Gene Name: LINC00847
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
624-643
0.042
2
RP11-776A13.3
hsa-miR-582-3p
0.873

Gene Details
Chromosome: 12
Transcript: ENST00000551287
Biotype: lincRNA
Gene id: ENSG00000257756
Gene Name: RP11-776A13.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
49-71
0.042
1
AC000403.4
hsa-miR-582-3p
0.872

Gene Details
Chromosome: 13
Transcript: ENST00000613696
Biotype: lincRNA
Gene id: ENSG00000278727
Gene Name: AC000403.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
475-492
0.025
1
8mer
2294-2311
0.011
1
6mer
261-281
0.003
2
6mer
2565-2574
0.002
2
RP1-27K12.2
hsa-miR-582-3p
0.872

Gene Details
Chromosome: 6
Transcript: ENST00000505995
Biotype: lincRNA
Gene id: ENSG00000231683
Gene Name: RP1-27K12.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
- Liver Normal/Primary
- Lung Normal/Primary
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
47-63
0.025
1
8mer
1562-1581
0.010
1
6mer
141-164
0.003
1
6mer
484-493
0.002
Not Conserved
6mer
1473-1484
0.001
1
RP11-691G17.1
hsa-miR-582-3p
0.872

Gene Details
Chromosome: 3
Transcript: ENST00000567488
Biotype: lincRNA
Gene id: ENSG00000261826
Gene Name: RP11-691G17.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
386-401
0.042
2
MIR205HG
hsa-miR-582-3p
0.872

Gene Details
Chromosome: 1
Transcript: ENST00000431096
Biotype: lincRNA
Gene id: ENSG00000230937
Gene Name: MIR205HG
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
20-33
0.038
8
6mer
483-506
0.004
3
LINC00562
hsa-miR-582-3p
0.871

Gene Details
Chromosome: 13
Transcript: ENST00000566385
Biotype: lincRNA
Gene id: ENSG00000260388
Gene Name: LINC00562
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
159-178
0.025
2
7mer
2117-2127
0.014
2
6mer
482-505
0.003
1
RP11-126H7.4
hsa-miR-582-3p
0.871

Gene Details
Chromosome: 10
Transcript: ENST00000372387
Biotype: antisense
Gene id: ENSG00000204049
Gene Name: RP11-126H7.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
64-83
0.042
1
RBFADN
hsa-miR-582-3p
0.870

Gene Details
Chromosome: 18
Transcript: ENST00000566810
Biotype: lincRNA
Gene id: ENSG00000261126
Gene Name: RBFADN
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
70-88
0.042
2
RP11-90L1.8
hsa-miR-582-3p
0.870

Gene Details
Chromosome: 13
Transcript: ENST00000611744
Biotype: antisense
Gene id: ENSG00000275880
Gene Name: RP11-90L1.8
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
170-190
0.035
1
6mer
9-36
0.006
1
RP1-27K12.2
hsa-miR-582-3p
0.868

Gene Details
Chromosome: 6
Transcript: ENST00000503985
Biotype: lincRNA
Gene id: ENSG00000231683
Gene Name: RP1-27K12.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
- Liver Normal/Primary
- Lung Normal/Primary
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
61-77
0.026
1
8mer
1576-1595
0.009
1
6mer
155-178
0.003
1
6mer
498-507
0.002
Not Conserved
6mer
1487-1498
0.001
1
AC016907.3
hsa-miR-582-3p
0.868

Gene Details
Chromosome: 2
Transcript: ENST00000455424
Biotype: antisense
Gene id: ENSG00000233862
Gene Name: AC016907.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
3103-3111
0.040
2
6mer
1461-1469
0.002
2
RP11-649E7.5
hsa-miR-582-3p
0.867

Gene Details
Chromosome: 14
Transcript: ENST00000555043
Biotype: antisense
Gene id: ENSG00000258377
Gene Name: RP11-649E7.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1684-1694
0.024
9
7mer
1290-1303
0.017
11
LINC00323
hsa-miR-582-3p
0.866

Gene Details
Chromosome: 21
Transcript: NR_024100.1
Biotype: lincRNA
Gene id: NR_024100.1 (gene)
Gene Name: LINC00323
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
171-184
0.033
1
6mer
92-109
0.005
2
6mer
1325-1339
0.004
2
AC072062.1
hsa-miR-582-3p
0.866

Gene Details
Chromosome: 2
Transcript: ENST00000420134
Biotype: antisense
Gene id: ENSG00000229267
Gene Name: AC072062.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
70-81
0.041
4
XLOC_000529
hsa-miR-582-3p
0.864

Gene Details
Chromosome: chr1
Transcript: TCONS_00001247
Biotype: transcript isomorph
Gene id: XLOC_000529
Gene Name: XLOC_000529
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Breast Normal/Primary
- Heart Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
323-329
0.037
6
6mer
3092-3107
0.002
2
6mer
2785-2796
0.001
1
MIR205HG
hsa-miR-582-3p
0.863

Gene Details
Chromosome: 1
Transcript: ENST00000429156
Biotype: lincRNA
Gene id: ENSG00000230937
Gene Name: MIR205HG
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
38-51
0.037
8
6mer
577-600
0.003
3
RP11-98O2.1
hsa-miR-582-3p
0.863

Gene Details
Chromosome: 4
Transcript: ENST00000513400
Biotype: lincRNA
Gene id: ENSG00000250501
Gene Name: RP11-98O2.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
616-623
0.041
2
Funded by: