Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-582-3p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
RP11-309L24.4
hsa-miR-582-3p
0.847

Gene Details
Chromosome: 7
Transcript: ENST00000609480
Biotype: lincRNA
Gene id: ENSG00000272899
Gene Name: RP11-309L24.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
3178-3205
0.039
Not Conserved
RP3-467N11.1
hsa-miR-582-3p
0.847

Gene Details
Chromosome: 6
Transcript: ENST00000565695
Biotype: antisense
Gene id: ENSG00000260000
Gene Name: RP3-467N11.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1328-1343
0.021
1
7mer
645-657
0.018
4
CTD-2281M20.1
hsa-miR-582-3p
0.847

Gene Details
Chromosome: 5
Transcript: ENST00000515704
Biotype: lincRNA
Gene id: ENSG00000250891
Gene Name: CTD-2281M20.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Heart Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
488-508
0.039
2
XLOC_010799
hsa-miR-582-3p
0.846

Gene Details
Chromosome: chr14
Transcript: TCONS_00022470
Biotype: transcript isomorph
Gene id: XLOC_010799
Gene Name: XLOC_010799
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Lung Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1337-1359
0.039
2
AC096670.3
hsa-miR-582-3p
0.846

Gene Details
Chromosome: 2
Transcript: ENST00000376593
Biotype: antisense
Gene id: ENSG00000204581
Gene Name: AC096670.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
252-267
0.018
1
8mer
2859-2871
0.016
1
6mer
2809-2833
0.004
2
AC073342.12
hsa-miR-582-3p
0.844

Gene Details
Chromosome: 7
Transcript: ENST00000446192
Biotype: antisense
Gene id: ENSG00000231840
Gene Name: AC073342.12
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
362-383
0.035
1
6mer
77-99
0.003
1
CTD-2203A3.1
hsa-miR-582-3p
0.842

Gene Details
Chromosome: 5
Transcript: ENST00000510583
Biotype: lincRNA
Gene id: ENSG00000248789
Gene Name: CTD-2203A3.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
273-299
0.038
2
RP11-445O3.3
hsa-miR-582-3p
0.842

Gene Details
Chromosome: 5
Transcript: ENST00000562127
Biotype: lincRNA
Gene id: ENSG00000260763
Gene Name: RP11-445O3.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
795-810
0.021
1
7mer
651-674
0.017
1
CTA-929C8.9
hsa-miR-582-3p
0.842

Gene Details
Chromosome: 22
Transcript: ENST00000624278
Biotype: sense_intronic
Gene id: ENSG00000279185
Gene Name: CTA-929C8.9
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
22452-22462
0.005
2
7mer
8112-8136
0.004
2
7mer
13053-13079
0.004
2
7mer
10160-10184
0.003
1
7mer
2244-2259
0.003
1
6mer
5281-5298
0.002
4
6mer
4454-4476
0.002
3
6mer
23631-23648
0.002
1
6mer
11249-11264
0.002
2
6mer
12509-12529
0.002
2
6mer
1220-1230
0.002
2
6mer
21751-21769
0.002
Not Conserved
6mer
5604-5619
0.002
1
6mer
15661-15680
0.001
1
6mer
5692-5711
0.001
3
6mer
12614-12633
0.001
Not Conserved
CTC-338M12.4
hsa-miR-582-3p
0.842

Gene Details
Chromosome: 5
Transcript: ENST00000599439
Biotype: retained_intron
Gene id: ENSG00000233937
Gene Name: CTC-338M12.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1305-1332
0.021
4
7mer
381-401
0.017
2
RP11-1018N14.5
hsa-miR-582-3p
0.841

Gene Details
Chromosome: 17
Transcript: ENST00000588341
Biotype: lincRNA
Gene id: ENSG00000267452
Gene Name: RP11-1018N14.5
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2781-2802
0.038
2
MEG3
hsa-miR-582-3p
0.841

Gene Details
Chromosome: 14
Transcript: ENST00000398474
Biotype: lincRNA
Gene id: ENSG00000214548
Gene Name: MEG3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
133-157
0.036
7
6mer
1132-1152
0.002
1
RP1-35C21.2
hsa-miR-582-3p
0.841

Gene Details
Chromosome: 1
Transcript: ENST00000458070
Biotype: lincRNA
Gene id: ENSG00000227579
Gene Name: RP1-35C21.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Kidney Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
501-509
0.038
7
RP11-486O13.2
hsa-miR-582-3p
0.840

Gene Details
Chromosome: 14
Transcript: ENST00000555480
Biotype: antisense
Gene id: ENSG00000258422
Gene Name: RP11-486O13.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
54-64
0.038
1
RP11-579D7.4
hsa-miR-582-3p
0.840

Gene Details
Chromosome: 12
Transcript: ENST00000549864
Biotype: lincRNA
Gene id: ENSG00000257660
Gene Name: RP11-579D7.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
107-117
0.038
8
MIR205HG
hsa-miR-582-3p
0.840

Gene Details
Chromosome: 1
Transcript: ENST00000603283
Biotype: lincRNA
Gene id: ENSG00000230937
Gene Name: MIR205HG
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
21-34
0.038
8
PPP3CB-AS1
hsa-miR-582-3p
0.839

Gene Details
Chromosome: 10
Transcript: ENST00000442133
Biotype: antisense
Gene id: ENSG00000221817
Gene Name: PPP3CB-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2156-2173
0.024
2
7mer
2484-2489
0.014
2
XLOC_007503
hsa-miR-582-3p
0.839

Gene Details
Chromosome: chr9
Transcript: TCONS_00016664
Biotype: transcript isomorph
Gene id: XLOC_007503
Gene Name: XLOC_007503
UCSC graphic: -
Expression:
  Cell Line Tissue Category
Fibroblasts Lung Normal/Primary
- Ovary Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
188-209
0.038
2
XLOC_010885
hsa-miR-582-3p
0.839

Gene Details
Chromosome: chr14
Transcript: TCONS_00022566
Biotype: transcript isomorph
Gene id: XLOC_010885
Gene Name: XLOC_010885
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1234-1241
0.038
2
TDRG1
hsa-miR-582-3p
0.835

Gene Details
Chromosome: 6
Transcript: NR_024015.1
Biotype: lincRNA
Gene id: NR_024015.1 (gene)
Gene Name: TDRG1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1046-1056
0.037
2
Funded by: